BOC Sciences provides a wide range of research chemicals and biochemicals including inhibitors, building blocks, GMP Products, impurities and metabolites, APIs for Veterinary, Natural Compounds, ADCs, Stem Cell Molecule and chiral compounds.
| Product | Description | |
|---|---|---|
| Copper(II) chloride dihydrate | Copper(II) chloride dihydrate. Alternative Names: CUPRIC CHLORIDE 2H2O; CUPRIC CHLORIDE 2-HYDRATE; COPPER (II) CHLORIDE; COPPER(II) CHLORIDE-2-HYDRATE; COPPER (II) CHLORIDE, HYDROUS; COPPER(+2)CHLORIDE DIHYDRATE; COPPER CHLORIDE DIHYDRATE; Copperdichloridedihydrate. Grades: 95%. CAS No. 10125-13-0. Molecular formula: CuCl2.2(H2O). Mole weight: 170.48. |  |
| Copper(II) citrate | Copper(II) citrate. Alternative Names: Citric acid, copper salt; Copper citrate; 1,2,3-Propanetricarboxylic acid, 2-hydroxy-, copper salt. Grades: Purity >98.5%. CAS No. 10402-15-0. Molecular formula: C6H8O7.xCu. Mole weight: 255.67. | |
| COPPER(II) CYCLOHEXANEBUTYRATE | COPPER(II) CYCLOHEXANEBUTYRATE. Alternative Names: CUPRIC CYCLOHEXANEBUTYRATE; COPPER(II) CYCLOHEXANEBUTYRATE; COPPER(II) 4-CYCLOHEXABUTYRATE; COPPER CYCLOHEXANEBUTYRATE; Cyclohexanebutanoicacid,copper(2+)salt; cyclohexanebutanoicacid,copper(2++)salt. Grades: 95%. CAS No. 2218-80-6. Molecular formula: C20H34CuO4. Mole weight: 402.03. | |
| Copper(II) hydroxide phosphate | Copper(II) hydroxide phosphate. CAS No. 12158-74-6. Molecular formula: Cu2HO5P. Mole weight: 239.07. | |
| Copper(II) iso-butyrate | Copper(II) iso-butyrate. Alternative Names: COPPER(II)I-BUTYRATE; Copper(II)isobutyrate; Copper(?)I-butyrate; Copper(II)i-butyrate,99%; Cupric isobutyrate; Copper()I-butyrate. CAS No. 15432-56-1. Molecular formula: C8H14CuO4. Mole weight: 237.74. | |
| Copper (II) Oxide | Copper (II) Oxide. Alternative Names: Copper(II)oxide; CUPRICOXIDE; oxocopper; Coppermonoxide; Copperoxide(CuO); Banacobruol. Grades: 95%. CAS No. 1317-38-0. Molecular formula: CuO. Mole weight: 79.54. | |
| Copper(II) phosphate | Copper(II) phosphate. Alternative Names: copperphosphate(3:2); copperphosphate(cu3(po4)2); cupricphosphate(cu3(po4)2); cupricphosphate,anhydrous; phosphoricacid,copper(2+)salt; Phosphoricacid,copper(2+)salt(2:3); phosphoricacid,copper(2++)salt(2:3); tricopperbis(orthophosphate). CAS No. 7798-23-4. Molecular formula: Cu3(PO4)2. Mole weight: 380.5807. | |
| Copper(II) phthalocyanine | Copper(II) phthalocyanine. Alternative Names: CuPc; Phthalocyanine blue; Pigment Blue 15. Grades: 95%. CAS No. 147-14-8. Molecular formula: C32H16CuN8. Mole weight: 576.07. | |
| Copper(II) propionate | Copper(II) propionate. Alternative Names: COPPER PROPIONATE; copper dipropionate; Copper(II) propionate. Grades: 95%. CAS No. 3112-74-1. Molecular formula: C6H10CuO4. Mole weight: 209.69. | |
| Copper(II) pyrophosphate | Copper(II) pyrophosphate. Alternative Names: Cupricpyrophosphate,trihydra; pyrophosphoricacid,coppersalt; COPPER (II) PYROPHOSPHATE; COPPER(II) DIPHOSPHATE TETRAHYDRATE; COPPER PYROPHOSPHATE; diphosphoric acid copper salt; CUPRIC PYROPHOSPHATE; CUPRIC PYROPHOSPHATE DIH2O. Grades: 95%. CAS No. 10102-90-6. Molecular formula: Cu2P2O7. Mole weight: 301.03. | |
| Copper(II) sulfate 1-hydrate | Copper(II) sulfate 1-hydrate. Alternative Names: COPPER(II) SULFATE HYDRATE 98; Copper sulfate hydrate; CUPRICSULFATE,MONOHYDRATE,PURIFIED; Copper sulfate monohydrate. CAS No. 10257-54-2. Molecular formula: CuSO4.H2O. Mole weight: 177.62. | |
| Copper(II) sulfate hydrate | Copper(II) sulfate hydrate. CAS No. 23254-43-5. Molecular formula: CuSO4 xH2O. Mole weight: 159.60 (anhydrous). | |
| Copper(II) sulfate pentahydrate | Copper(II) sulfate pentahydrate. Alternative Names: Cupri sulfas pentahydricus; Cupric sulphate hydrated; Cupric sulphate, pentahydrated; Cupric sulfate, pentahydrated; Cupric sulfate TS; Cupric sulphate 5H2O. Grades: 99%. CAS No. 7758-99-8. Molecular formula: CuH10O9S. Mole weight: 249.68. | |
| Copper(II) tartrate hydrate | Copper(II) tartrate hydrate. Alternative Names: Butanedioic acid, 2,3-dihydroxy-, (2R,3R)-, copper(2+) salt, hydrate (1:1:x); Butanedioic acid, 2,3-dihydroxy-, [R-(R*,R*)]-, copper(2+) salt, hydrate (1:1:x); Copper tartrate hydrate; Cupric tartrate hydrate. CAS No. 946843-80-7. Molecular formula: C4H4CuO6.xH2O. Mole weight: 211.62 (anhydrous). | |
| Copper(I) phosphide | Copper(I) phosphide. Alternative Names: CUPROUS PHOSPHIDE; CUPRIC PHOSPHIDE; COPPER PHOSPHIDE; tricopper phosphide; cuprousphosphide99.5%; Copper(II) phosphide; COPPER(I)PHOSPHIDE; Phosphinidynetricopper(I). Grades: 95%. CAS No. 12019-57-7. Molecular formula: Cu3P2. Mole weight: 252.59. | |
| Copper oxychloride | Copper oxychloride. Alternative Names: Copper chloride oxide, hydrate (1:x); Blitox; Funguram; Cupric oxychloride; Cupravit; Cupox; Cuprokylt; Cobox; Coprantol; Copper chloride oxide, hydrate; Basic cupric oxychloride; Cupric oxide chloride; Turbair Copper Fungicide; Turdacupral; Viricuivre; Vitigran Blue. CAS No. 1332-40-7. | |
| Copper Peptide (GHK2-Cu) | GHK2-Cu stimulates the production of collagen and is used in the anti-aging products. GHK2-Cu also exhibits therapeutic effect on hair loss. Alternative Names: Bisprezatide Copper; GHK2 copper. CAS No. 130120-56-8. Molecular formula: C28H46CuN12O8. Mole weight: 742.298. | |
| Copper phosphorus shot | Copper phosphorus shot. Alternative Names: COPPER PHOSPHORUS; Copper Phosphorus shot. Grades: 95%. CAS No. 12517-41-8. Molecular formula: CuP. Mole weight: 94.52. | |
| Copper phthalocyanine-3,4,4,4-tetrasulfonic acid tetrasodium salt | Copper phthalocyanine-3,4,4,4-tetrasulfonic acid tetrasodium salt. Alternative Names: 3,4',4'',4'''-Tetrasulfonylcopperphthalocyanine,tetrasodiumsalt; 123439-80-5; AC1MHJ5F. Grades: 95%. CAS No. 123439-80-5. Molecular formula: C32H16CuN8O12S4. Mole weight: 984.25. | |
| Copper sulfate basic | Copper sulfate basic. Alternative Names: Sulfuric acid, copper salt, basic; COPPERSULPHATE,BASIC; Sulfuric acid, copper salt, basic, copper sulfate(basic); Basic copper sulfate; Copper sulfate basic. CAS No. 1344-73-6. Molecular formula: CuSO4.3Cu(OH)2.H20. Mole weight: 470.29. | |
| Coproporphyrin III | Coproporphyrin III. Alternative Names: 21H,23H-Porphine-2,7,12,18-tetrapropanoic acid, 3,8,13,17-tetramethyl-. CAS No. 14643-66-4. Molecular formula: C36H38N4O8. Mole weight: 654.72. | |
| Coptisine | Coptisine exerts a strong anti-osteosarcoma effect with very low toxicity and is a potential anti-osteosarcoma drug candidate. Uses: Anti-osteosarcoma. Alternative Names: Coptisin; 5,6-Dihydro-2,3:9,10-bis(methylenedioxy)dibenzo[a,g]quinolizinium; bis[methylenedioxy]protoberberine. Grades: 98%. CAS No. 3486-66-6. Molecular formula: C19H14NO4. Mole weight: 320.32. | |
| CoQ8 | CoQ8 is an isoprenoid quinone that enhances nonspecific resistance to bacterial infections. It stimulates phagocytosis in macrophages by modulation of the kinetics of the Fc receptor. It acts as an electron carrier from flavin protein to cytochrome complex in recombinant protein liposomes, and cytochrome O complex acts as a highly efficient ubiquitin-8 oxidase. Alternative Names: Coenzyme Q8 (E. coli); Ubiquinone-40; Ubiquinone-Q8; Ubiquinone-8; 2,3-Dimethoxy-5-methyl-6-[(2E,6E,10E,14E,18E,22E,26E)-3,7,11,15,19,23,27,31-octamethyl-2,6,10,14,18,22,26,30-dotriacontaoctaenyl]-2,5-cyclohexadiene-1,4-dione; 2,3-Dimethoxy-5-methyl-6-(3,7,11,15,19,23,27,31-octamethyl-2,6,10,14,18,22,26,30-dotriacontaoctaenyl)-p-benzoquinone; (all-E)-2,3-Dimethoxy-5-methyl-6-(3,7,11,15,19,23,27,31-octamethyl-2,6,10,14,18,22,26,30-dotriacontaoctaenyl)-2,5-cyclohexadiene-1,4-dione. Grades: >99%. CAS No. 2394-68-5. Molecular formula: C49H74O4. Mole weight: 727.11. | |
| Cordycepin 5-triphosphate sodium salt | Cordycepin 5-triphosphate sodium salt. Alternative Names: 3-Deoxyadenosine 5-triphosphate. Grades: 95%. CAS No. 71997-32-5. Molecular formula: C10H12N5Na4O12P3. Mole weight: 579.11. | |
| COREY LACTONE DIOL | COREY LACTONE DIOL. Alternative Names: COREY LACTONE DIOL; (3AR,4S,5R,6AS)-(-)-HEXAHYDRO-5-HYDROXY-4-(HYDROXYMETHYL)-2H-CYCLOPENT A[B]FURAN-2-ONE; (3AR,4S,5R,6AS)-HEXAHYDRO-5-HYDROXY-4-(HYDROXYMETHYL)-2H-CYCLOPENTA[B]FURAN-2-ONE; (-)-6BETA-HYDROXYMETHYL-7ALPHA-HYDROXY-CIS-2-OXABICYCLO[3.3.0]OCTA. Grades: 95%. CAS No. 32233-40-2. Molecular formula: C8H12O4. Mole weight: 172.18. | |
| Corey lactone THP | Corey lactone THP, being an organic compound, has proven to be an essential building block in synthesizing several drugs, distinguishedly an antitumor agent and an angiotensin-converting enzyme inhibitor. Additionally, it finds its application as a safeguarding group for alcohols during organic synthesis. Its utilization in these domains is of critical significance owing to its potential in enhancing drug efficacy. Alternative Names: (3aR,4S,5R,6aS)-4-(Hydroxymethyl)-5-((tetrahydro-2H-pyran-2-yl)oxy)hexahydro-2H-cyclopenta[b]furan-2-one; 2H-Cyclopenta[b]furan-2-one, hexahydro-4-(hydroxymethyl)-5-[(tetrahydro-2H-pyran-2-yl)oxy]-, (3aR,4S,5R,6aS)-. Grades: 95%. CAS No. 69222-61-3. Molecular formula: C13H20O5. Mole weight: 256.29. | |
| Coriamyrtin | Coriamyrtin. Alternative Names: Coriamyrtin. CAS No. 2571-86-0. Molecular formula: C15H18O5. Mole weight: 278.3. | |
| corn gluten meal | corn gluten meal. Alternative Names: CORN GLUTEN MEAL; GLUTEN, ENZYMATIC HYDROLYSATE; GLUTEN HYDROLYSATE; corn; cornglutens; glutens,corn; ZEA MAYS (CORN) KERNEL MEAL; Gluten, corn. Grades: 95%. CAS No. 66071-96-3. | |
| Corn protein hydrolyzate | Corn protein hydrolyzate. Grades: 95%. CAS No. 100209-41-4. | |
| Corn steep liquor | Corn steep liquor. Grades: 95%. CAS No. 66071-94-1. | |
| Coronaridine | Coronaridine is an alkaloid found in Voacanga schweinfurthii and Tabernanthe iboga. Coronaridine inhibits the Wnt signaling pathway by decreasing β-catenin mRNA expression. Alternative Names: Methyl ibogamine-18-carboxylate; (-)-Coronaridine. Grades: 95%. CAS No. 467-77-6. Molecular formula: C21H26N2O2. Mole weight: 338.44. | |
| Coronene | Coronene (CAS# 191-07-1) is a polycyclic aromatic hydrocarbon found in smoked fish and was examined for potential toxic and carcinogenic effects. Alternative Names: coronene. Grades: > 95.0 % (GC). CAS No. 191-07-1. Molecular formula: C24H12. Mole weight: 300.35. | |
| Cortexolone 17 alpha-propionate | Cortexolone 17 alpha-propionate, also called as CB-03-01, belonging to the family of ester derivatives of cortexolone, is a potent and topical and peripherally selective steroid antagonist of androgen. Alternative Names: CB-03-01; CB 03-01; CB03-01; [(8R,9S,10R,13S,14S,17R)-17-(2-hydroxyacetyl)-10,13-dimethyl-3-oxo-2,6,7,8,9,11,12,14,15,16-decahydro-1H-cyclopenta[a]phenanthren-17-yl] propanoateCB-03-01cortexolone 17alpha-propionate. CAS No. 19608-29-8. Molecular formula: C24H34O5. Mole weight: 402.52. | |
| corticosterone-21-hemisuccinate | Corticosterone-21-Hemisuccinate is an adrenocortical steroid. Alternative Names: Corticosterone 21-hemisuccinate; Corticosterone hemisuccinate; 4-[(11-Hydroxy-3,20-dioxopregn-4-en-21-yl)oxy]-4-oxobutanoic acid. Grades: 95%. CAS No. 10215-77-7. Molecular formula: C25H34O7. Mole weight: 446.54. | |
| Corticosterone 21-hemisuccinate | Corticosterone 21-hemisuccinate. Alternative Names: CORTEXONE 21-HEMISUCCINATE; CORTEXONE HEMISUCCINATE; CORTEXONE HEMISUCCINATE:BSA; DOC HEMISUCCINATE; DOC HEMISUCCINATE BSA; DOC HEMISUCCINATE:BSA; DEOXYCORTICOSTERONE 21-HEMISUCCINATE; DESOXYCORTICOSTERONE HEMISUCCINATE. CAS No. 10215-74-4. Molecular formula: C25H34O6. Mole weight: 430.53. | |
| Corundum | Corundum. Alternative Names: abramantf36; abramaxf46; abramaxf54; alpha-corundum; aluminiumoxideceramic; aluminiumoxidewafer; Corundum(Al2O3); duralf30. CAS No. 1302-74-5. Molecular formula: Al2O3. Mole weight: 101.96. | |
| Corynoxine B | Corynoxine B, a natural autophagy inducer, restores the deficient cytosolic translocation of HMGB1 and autophagy in cells overexpressing SNCA, which may be attributed to its ability to block SNCA-HMGB1 interaction. Corynoxine B exhibited prolongation of the thiopental-induced hypnosis on oral administration in mice. Alternative Names: Corynoxine B. Grades: 97%. CAS No. 17391-18-3. Molecular formula: C22H28N2O4. Mole weight: 384.47. | |
| Cosmone | Cosmone. CAS No. 259854-70-1. Molecular formula: C15H26O. Mole weight: 222.37. | |
| Cotinine | Cotinine is the major metabolite of nicotine. It is an alkaloid commonly found in Nicotiana tabacum. It has a role as a biomarker, an antidepressant, a plant metabolite, and a human xenobiotic metabolite. Uses: A carcinogen as a a major metabolite of nicotine in humans. Alternative Names: Nicotine Impurity C; Nicotine EP Impurity C; (5S)-1-methyl-5-(pyridin-3-yl)pyrrolidin-2-one; 2-Pyrrolidinone, 1-methyl-5-(3-pyridinyl)-, (5S)-; S-(-)-Cotinine; NIH 10498; NIH10498; NIH-10498; (-)-Cotinine; (5S)-1-Methyl-5-(3-pyridinyl)-2-pyrrolidinone; (S)-(-)-1-Methyl-5-(3-pyridiyl)-2-pyrrolidinone; 2-Pyrrolidinone, 1-methyl-5-(3-pyridinyl)-, (S)-; (S)-Cotinine. Grades: ≥95%. CAS No. 486-56-6. Molecular formula: C10H12N2O. Mole weight: 176.22. | |
| Cottonseed oil | Cottonseed oil is a natural vegetable oil with insecticidal properties, mainly used as a solvent for intramuscular injection. Alternative Names: FMC 710; Fats and Glyceridic oils, cottonseed; Gossypium hirsutum seed oil; Oils, cottonseed; Oils, glyceridic, cottonseed; Cotton oil; refined cottonseed oil. Grades: 95%. CAS No. 8001-29-4. | |
| Cottonseed oil, hydrogenated | It can be used as a lubricant in tablet and capsule preparations, as an auxiliary binder in tablet formulations, and as a coating aid in controlled-release preparations. Alternative Names: Akofine NF; Cotmar; Cottonseed oils, hydrogenated; Dri-Tex; Dritex C; GKhM 5T; Hardened cottonseed oil; Hardened cottonseed oils; Hydrogenated cottonseed oil; Hydrogenated cottonseed oils; Hydrogenated vegetable oils, cottonseed; RTU 186-61; Stearine 07; Sterotex; Sterotex NF; Sterotex NF lubricant; Sterotex NF-C. Grades: 98%. CAS No. 68334-00-9. | |
| COUMAPHOS-OXON | COUMAPHOS-OXON. Alternative Names: COUMAPHOS-O-ANALOG; COUMAPHOS-O-ANALOGUE; COUMAPHOS-OXON; PHOSPHORIC ACID 3-CHLORO-4-METHYL-2-OXO-2H-CHROMEN-7-YL ESTER DIETHYL ESTER; 3-chloro-4-methyl-7-coumarinyldiethylphosphate; 3-chloro-7-hydroxy-4-methyl-coumaridiethylphosphate. Grades: 95%. CAS No. 321-54-0. Molecular formula: C14H16ClO6P. Mole weight: 346.7. | |
| Coumaran | Coumaran is a natural product found in Trigonella foenum-graecum, Xylaria, and other organisms with data available. Coumaran is an acetylcholinesterase (AChE) inhibitor isolated from leaves of L. camara. Alternative Names: 2,3-Dihydrobenzofuran; Benzofuran, 2,3-dihydro-; Kumaran; Dihydrocoumarone. CAS No. 496-16-2. Molecular formula: C8H8O. Mole weight: 120.15. | |
| Coumarin 153 | Coumarin 153, a photophysical molecule with fluorescent properties, is a commonly applied dye within biomedical research and imaging. Its versatility ranges from labeling and tracking protein-protein interactions to detecting particular cellular components. Moreover, Coumarin 153 plays a vital role in the design and development of sophisticated imaging techniques for identifying and treating cancer. Uses: Coumarin 153 is used as laser dyes. Alternative Names: Cumarin153;Coumarin 540A; 2,3,6,7-tetrahydro-9-(trifluoromethyl)-1H,5H,11H-[1]benzopyrano[6,7,8-ij]quinolizin-11-one; 2,3,6,7-Tetrahydro-9-trifluoromethyl-1H,5H-quinolizino(9,1-gh)coumarin. Grades: >95.0%. CAS No. 53518-18-6. Molecular formula: C16H14F3NO2. Mole weight: 309.28. | |
| Coumarin 2 | Coumarin 2 is used as an efficient laser dye for both pulsed and CW operation. Uses: Coumarins are used as laser dyes. Alternative Names: Coumarin 450; 7-(ethylamino)-4,6-dimethyl-2H-1-benzopyran-2-one. CAS No. 26078-25-1. Molecular formula: C13H15NO2. Mole weight: 217.27. | |
| Coumarin 487 | Coumarin 487 is a biopharmaceutical compound with anti-inflammatory and analgesic properties. Coumarin 487 is of importance due to its powerful ability to act as an inhibitor of the harmful cyclooxygenase-2 (COX-2). Molecular formula: C19H23NO2. Mole weight: 297.397. | |
| Coumarin 490 | Coumarin 490 is a laser dye. Alternative Names: 7-amino-4-(trifluoromethyl)-2H-1-benzopyran-2-one; Coumarin 151; 7-Amino-4-(trifluoromethyl)coumarin. CAS No. 53518-15-3. Molecular formula: C10H6F3NO2. Mole weight: 229.16. | |
| Coumarin 503 | Coumarin 503 is an illustrious compound widely utilized within the biomedical industry and has garnered significant attention owing to its formidable potential in combatting an array of ailments encompassing cancer, inflammation, and cardiovascular disorders. Its exceptional attributes, characterized by robust antioxidant and anti-inflammatory properties, endow it with indispensability as an invaluable instrument in the field of drug discovery and advancement. Alternative Names: 7-(ethylamino)-6-methyl-4-(trifluoromethyl)-2H-1-benzopyran-2-one; Coumarin 307. CAS No. 55804-70-1. Molecular formula: C13H12F3NO2. Mole weight: 271.23. | |
| Coumarin 504T | Coumarin 504T is a versatile biomedical compound and a promising drug for exploring a range of diseases. It is primarily used in drug research, and its potential to fight horrific malignancies such as breast, lung and colon cancer is astounding. Notably, this compound exhibited significant inhibitory effects against the potent HIV-1. Alternative Names: Coumarin 314T; 2,3,6,7-tetrahydro-1,1,7,7-tetramethyl-11-oxo-1H,5H,11H-[1]benzopyrano[6,7,8-ij]quinolizine-10-carboxylic acid, ethyl ester. CAS No. 113869-06-0. Molecular formula: C22H27NO4. Mole weight: 369.46. | |
| Coumarin 519 | Coumarin 519 is a synthetic fluorescent dye widely used in biomedical research. It serves as a valuable tool for studying drug distribution and pharmacokinetics, as well as for monitoring membrane potential and calcium signaling in live cells. Additionally, it finds applications in fluorescence microscopy, flow cytometry, and bioimaging techniques. Alternative Names: 2,3,6,7-tetrahydro-11-oxo-1H,5H,11H-[1]benzopyrano[6,7,8-ij]quinolizine-10-carboxylic acid; Coumarin 343. CAS No. 55804-65-4. Molecular formula: C16H15NO4. Mole weight: 285.29. | |
| CP 100356 hydrochloride | The hydrochloride salt form of CP-100356, which has been found to be an inhibitor of MDR1 (P-Gp) and show inactive in inhibiting multidrug resistance-associated protein 2 (MPR2). Alternative Names: CP 100356 hydrochloride; CP100356 hydrochloride; CP-100356 hydrochloride; 4-(3,4-Dihydro-6,7-dimethoxy-2(1H)-isoquinolinyl)-N-2[2-(3,4-dimethoxyphenyl)ethyl]-6,7-dimethoxy-2-quinazolinamine hydrochloride. Grades: ≥98% by HPLC. CAS No. 142715-48-8. Molecular formula: C31H36N4O6.HCl. Mole weight: 597.10. | |
| CP-456773 sodium | CP-456773, also known as MCC950 and CRID3, is a potent, orally bioavailable NLRP3 inflammasome inhibitor and inhibits IL-1β (IC50 = 7.2 nM), IL-1α (IC50 = 12-18 nM) and IL-18 (IC50 = 10.3 nM) production for the treatment of inflammatory diseases. Alternative Names: sodium ((1,2,3,5,6,7-hexahydro-s-indacen-4-yl)carbamoyl)((4-(2-hydroxypropan-2-yl)furan-2-yl)sulfonyl)amide; MCC950; MCC 950; MCC-950; CP-45677; CP45677; CP 45677; CRID-3; CRID3; CRID 3; CP-456773 sodium salt; CP 456773 sodium salt; CP456773 sodium salt; Cytokine release inhibitory drug 3. CAS No. 256373-96-3. Molecular formula: C20H24N2NaO5S. Mole weight: 427.46. | |
| CP-457920 | CP-457920, also called as NGD 971, is a selective α5 GABAA receptor inverse agonist (Ki of ~ 1 ng/mL). CP-457920 was progressed into clinical studies for the treatment of Vascular dementia but discontinued. Alternative Names: N-benzyl-6-ethoxy-4-oxo-1H-1,5-naphthyridine-3-carboxamide; CP-457920; CP457920; CP 457920; UNII-13BME2F602; CP-457,920. Grades: >98%. CAS No. 220860-50-4. Molecular formula: C18H17N3O3. Mole weight: 323.35. | |
| CP-673451 | CP-673451 is a selective inhibitor of PDGFRα/β with IC50 of 10 nM/1 nM, exhibits >450-fold selectivity over other angiogenic receptors, has antiangiogenic and antitumor activity. Alternative Names: CP-673451; CP673451; CP 673451; CP-673,451; CP 673451; CP 673,451. Grades: >98%. CAS No. 343787-29-1. Molecular formula: C24H27N5O2. Mole weight: 417.5. | |
| CP-91149 | CP-91149 is a selective glycogen phosphorylase (GP) inhibitor with IC50 of 0.13 μM in the presence of glucose, 5- to 10-fold less potent in the absence of glucose. Alternative Names: CP 91149; CP91149; 5-Chloro-1H-indole-2-carboxylic acid ((1S,2R)-1-benzyl-2-dimethylcarbamoyl-2-hydroxy-ethyl)-amide. Grades: >98%. CAS No. 186392-40-5. Molecular formula: C21H22ClN3O3. Mole weight: 399.87. | |
| CP 96345 | CP 96345 is an effective and selective non-peptide NK1 receptor antagonist and has been found to show activities in restraining neurogenic inflammation in vivo. Uses: Hypnotics and sedatives. Alternative Names: CP-96345; CP 96345; CP96345; (2S,3S)-N-(2-Methoxyphenyl)methyl-2-diphenylmethyl-1-azabicyclo[2.2.2]octan-3-amine. Grades: ≥98% by HPLC. CAS No. 132746-60-2. Molecular formula: C28H32N2O. Mole weight: 412.57. | |
| CPG52364 | CPG52364 a small molecule toll-like receptor(TLR) antagonist, which is a type I transmembrane receptors and the central components of the innate immune system. It has recently completed phase 1 clinical trial for SLE therapy. Uses: Cpg52364 is used for the sle therapy. Alternative Names: CPG-52364; CPG 52364; CPG52364; 6,7-Dimethoxy-2-(4-(4-methylpiperazin-1-yl)phenyl)-N-(2-morpholinoethyl)quinazolin-4-amine. Grades: >98%. CAS No. 1093135-60-4. Molecular formula: C27H36N6O3. Mole weight: 492.62. | |
| CpG-ODN 2135 | CpG-ODN 2135 can induce equine peripheral blood mononuclear cell proliferation in vitro. Alternative Names: TCGTCGTTTGTCGTTTTGTCGTT; CpG ODN 2135; CpG 2135; ODN 2135. | |
| C-Phycocyanin from Spirulina sp. | C-Phycocyanin from Spirulina sp. CAS No. 11016-15-2. | |
| CPI-613 | CPI-613 is a racemic mixture of the enantiomers of a synthetic alpha-lipoic lipoic acid analogue with potential chemopreventive and antineoplastic activities. Although the exact mechanism of action is unknown, alpha-lipoic acid analogue CPI-613 has been shown to inhibit metabolic and regulatory processes required for cell growth in solid tumors. Both enantiomers in the racemic mixture exhibit antineoplastic activity. The mechanism-of-action of CPI-613 appears distinct from the current classes of anti-cancer agents used in the clinic. CPI-613 demonstrates both in vitro and in vivo anti-tumor activity. CPI-613 was known to strongly disrupt tumor mitochondrial metabolism. CPI-613 disruption of tumor mitochondrial metabolism is followed by efficient commitment to cell death by multiple, apparently redundant pathways, including apoptosis, in all tested cancer cell lines. Further, CPI-613 shows strong antitumor activity in vivo against human non-small cell lung and pancreatic cancers in xenograft models with low side-effect toxicity. Alternative Names: CPI613; CPI 613; Devimistat; 6,8-bis(benzylthio)octanoic acid. Grades: 98%. CAS No. 95809-78-2. Molecular formula: C22H28O2S2. Mole weight: 388.59. | |
| CPYPP | CPYPP has been found to be a DOCK2-Rac1 interaction inhibitor and could probably attenuate HER2-mediated breast cancer cell migration. Alternative Names: 4-[3-(2-Chlorophenyl)-2-propen-1-ylidene]-1-phenyl-3,5-pyrazolidinedione. Grades: ≥98% by HPLC. CAS No. 310460-39-0. Molecular formula: C18H13ClN2O2. Mole weight: 324.76. | |
| Cranad 58 | Cranad 58. CAS No. 1473403-16-5. Molecular formula: C24H28BF2N3O2. Mole weight: 439.3. | |
| Cranberry Extract | The active ingredients of Cranberry Extract are anthocyanins and procyanidins, which have strong antioxidant, anti-inflammatory and anti-mutation effects, scavenging free radicals, and improving sleep. It can be used in cosmetics material. Alternative Names: BILBERRY EXTRACT; Vaccinium myrtillus, ext.; Bilberry Seed Oil; Blue Tocal Bilberry Seed Oil; Vaccinium Myrtillus; VACCINIUM MYRTILLUS EXTRACT; BILBERRY EXTRACT 25%; BILBERRYFRUITEXTRACT. Grades: 5%-25% (Anthocyanidin); 10:1. CAS No. 84082-34-8. Molecular formula: C27H31O16. Mole weight: 611.53. | |
| CRATAEGUS MONOGINA FRUIT EXTRACT | CRATAEGUS MONOGINA FRUIT EXTRACT. Grades: 95%. CAS No. 8057-51-0. | |
| Creatine | Creatine is an amino acid produced by vertebrate animals. It can act as a neuroprotective agent. Alternative Names: Creatin; Kreatin; N-amidinosarcosine. CAS No. 57-00-1. Molecular formula: C4H9N3O2. Mole weight: 131.13. | |
| CREATINE AMIDINOHYDROLASE | CREATINE AMIDINOHYDROLASE. Alternative Names: EC 3.5.3.3; CREATINE AMIDINOHYDROLASE; CREATINASE; creatinase from actinobacillus species; creatinase from flavobacterium sp.; creatinase from pseudomonas species:*recombinant; CREATINASE FROM FLAVOBACTERIUM SPECIES; CREATINASE FROM FLAVOBACTERIUM SP., LYOP HIL. Grades: 95%. CAS No. 37340-58-2. | |
| Creatine Hydrochloride | Creatine is found in vertebrates where it facilitates recycling of adenosine triphosphate (ATP). Creatine can be used as a buffer. Nutritional supplement in health care products. Uses: Ingredient of health care products. Alternative Names: Creatine HCl; 2-(1-Methylguanidino)acetic acid hydrochloride; 2-[carbamimidoyl(methyl)amino]acetic acid hydrochloride. Grades: 95%. CAS No. 17050-09-8. Molecular formula: C4H10ClN3O2. Mole weight: 167.593. | |
| Creatine monohydrate | Creatine is found in vertebrates where it facilitates recycling of adenosine triphosphate (ATP). Creatine can be used as a buffer.Nutritional supplement in health care products. Uses: Ingredient of health care products. Alternative Names: 2-[carbamimidoyl(methyl)amino]acetic acid;hydrate. CAS No. 6020-87-7. Molecular formula: C4H11N3O3. Mole weight: 149.15. | |
| Creatine Phosphate Disodium Salt Tetrahydrate | Creatine Phosphate Disodium Salt Tetrahydrate is a crucial compound in the biomedical industry playing a vital role in cellular metabolism. This product is utilized in researchs targeting various neuromuscular disorders, such as muscular dystrophy and chronic fatigue syndrome. Alternative Names: Sodium creatine phosphate dibasic tetrahydrate. Grades: > 95%. CAS No. 71519-72-7. Molecular formula: C4H8N3O5PNa2 4H2O. Mole weight: 327.14. | |
| Creatine pyruvate | Creatine pyruvate. CAS No. 55965-97-4. Molecular formula: C7H13N3O5. Mole weight: 219.2. | |
Our database is helping our users find suppliers everyday.
