BOC Sciences provides a wide range of research chemicals and biochemicals including inhibitors, building blocks, GMP Products, impurities and metabolites, APIs for Veterinary, Natural Compounds, ADCs, Stem Cell Molecule and chiral compounds.
×
Product
Description
Suppliers Website
Silychristin
Silychristin is a new natural product has been isolated from silymarin, the hepatoprotective extract of milk thistle (Silybum marianum) fruits. Silychristin has been shown to be an antihepatotoxic flavonolignan. Alternative Names: (3R,3aR,6R,7aR,8R)-4-[(2R,3R)-3,4-Dihydro-3,5,7-trihydroxy-4-oxo-2H-1-benzopyran-2-yl]-2,3,3a,7a-tetrahydro-7a-hydroxy-8-(4-hydroxy-3-methoxyphenyl)-3,6-methanobenzofuran-7(6H)-one; 3R-[3α,3aβ,4(2R*,3R*),6α,7aβ,8R*]]-4-(3,4-Dihydro-3,5,7-trihydroxy-4-oxo-2H-1-benzopyran-2-yl)-2,3,3a,7a-tetrahydro-7a-hydroxy-8-(4-hydroxy-3-methoxyphenyl)-3,6-methanobenzofuran-7(6H)-one; (+)-2,3α,3aα,7a-Tetrahydro-7aα-hydroxy-8-(4-hydroxy-3-methoxyphenyl)-4-(3α,5,7-trihydroxy-4-oxo-2β-chromanyl)-3,6-methanobenzofuran-7(6αH)-one; Silidianin; Silidianine; Silydianin. Grades: >98%. CAS No. 33889-69-9. Molecular formula: C25H22O10. Mole weight: 482.4.
Silymarin
Silymarin is a flavonolignan, obtained from milk thistle (Silybum marianum) plant. It exhibits in vitro antiviral, antibacterial, antifungal activities and cytotoxicity. Alternative Names: Apihepar; Darsil; Flavobion; Karsilin; Laragon. Grades: >80%. CAS No. 65666-07-1. Molecular formula: C25H22O10. Mole weight: 482.44.
SIMA phosphoramidite, 6-isomer
SIMA (dichloro-diphenyl-fluorescein) is a xanthene dye with spectral characteristics similar to those of HEX but with a higher quantum yield. SIMA phosphoramidite is used in oligonucleotide synthesis to produce fluorescently labeled primers and hybridization probes for quantitative PCR. Alternative Names: 6-(4,7-Dichloro-2',7'-diphenyl-3',6'-dipivaloylfluorescein-6-carboxamido)-hexyl-1-O-(2-cyanoethyl)-(N,N-diisopropyl)-phosphoramidite; Propanoic acid, 2,2-dimethyl-, 1,1'-[6-[10-[bis(1-methylethyl)amino]-13-cyano-1-oxo-9,11-dioxa-2-aza-10-phosphatridec-1-yl]-4,7-dichloro-3-oxo-2',7'-diphenylspiro[isobenzofuran-1(3H),9'-[9H]xanthene]-3',6'-diyl] ester; 1,1'-[6-[10-[Bis(1-methylethyl)amino]-13-cyano-1-oxo-9,11-dioxa-2-aza-10-phosphatridec-1-yl]-4,7-dichloro-3-oxo-2',7'-diphenylspiro[isobenzofuran-1(3H),9'-[9H]xanthene]-3',6'-diyl] bis(2,2-dimethylpropanoate); SIMA; SIMA phosphoramidite, 6-isomer. CAS No. 1411797-05-1. Molecular formula: C58H64N3Cl2O10P. Mole weight: 1065.02.
Simethicone
Simethicone is an antifoaming agent. Alternative Names: Aligest Plus; Antifoam A; Barcroft SIM-DC 100; DC Antifoam A; Dow Antifoam A; Dow Corning Antifoam A; Espumisan; Gas-X; KS 66; KS 66 (silicone); Mylicon; Q 7-2587; Sentry Simethicone GS; Silfoam SE 2; Simiticone; SonoRx; Xiameter AFE 0100; Xiameter AFE 0100 Antifoam Emulsion Food Grade; a-(Trimethysilyl-o-methylpoly[oxy(dimethylsilylene)], mixture with silicon dioxide; polydimethylsiloxane-silicon dioxide mixture; Sentry Simethicone; Simeticonum. CAS No. 8050-81-5. Molecular formula: (C2H6OSi)n.SiO2.
Simvastatin EP Impurity C
An impurity of Simvastatin. Simvastatin is a lipid-lowering drug that inhibits HMG-CoA reductase. It is in the statin class of medications and works by decreasing the manufacture of cholesterol by the liver. Alternative Names: Simvastatin USP Related Compound C; 2,3-Anhydro Simvastatin; Dehydro Simvastatin; Anhydro simvastatin. Grades: 95%. CAS No. 210980-68-0. Molecular formula: C25H36O4. Mole weight: 400.56.
Simvastatin EP Impurity H
An intermediate in the synthesis of Simvastatin, Simvastatin is a lipid-lowering drug that inhibits HMG-CoA reductase. It is in the statin class of medications and works by decreasing the manufacture of cholesterol by the liver. Alternative Names: Lovastatin Lactone Diol; Monacolin J; Antibiotic MB 530A; 6(R)-[2-(8(S)-Hydroxy]-2(S),6(R)-dimethyl-1,2,6,7,8,8a(R)-hexahydro-1(S)-naphthyl]ethyl-4(R)-hydroxy-3,4,5,6-tetrahydro-2H-pyran-2-one. Grades: > 95%. CAS No. 79952-42-4. Molecular formula: C19H28O4. Mole weight: 320.43.
Simvastatin EP Impurity M
An impurity of Simvastatin. Simvastatin is a lipid-lowering drug that inhibits HMG-CoA reductase. It is in the statin class of medications and works by decreasing the manufacture of cholesterol by the liver. Alternative Names: Simvastatin Ethyl Ester; Ethyl (βR,δR,1S,2S,6R,8S,8aR)-8-(2,2-dimethyl-1-oxobutoxy)-1,2,6,7,8,8a-hexahydro-β,δ-dihydroxy-2,6-dimethyl-1-naphthaleneheptanoate. Grades: > 95%. CAS No. 864357-87-9. Molecular formula: C27H44O6. Mole weight: 464.63.
Simvastatin EP Impurity N
An impurity of Simvastatin. Simvastatin is a lipid-lowering drug that inhibits HMG-CoA reductase. It is in the statin class of medications and works by decreasing the manufacture of cholesterol by the liver. Alternative Names: Methylsimvastatin; 5-Methylsimvastatin; 2-Methyl Simvastatin (Mixture Of Diasteroisomers); 2,2-Dimethyl-(1S,3R,7S,8S,8aR)-1,2,3,7,8,8a-Hexahydro-3,7-dimethyl-8-[2-[(2R,4R)-tetrahydro-4-hydroxy-5-methyl-6-oxo-2H-pyran-2-yl]ethyl]-1-naphthalenyl Ester Butanoic Acid. CAS No. 774611-54-0. Molecular formula: C26H40O5. Mole weight: 432.59.
Sinalbin
Sinalbin. Alternative Names: β-D-Glucopyranose, 1-thio-, 1-[4-hydroxy-N-(sulfooxy)benzeneethanimidate], ion(1-), 2-[[3-(4-hydroxy-3,5-dimethoxyphenyl)-1-oxo-2-propen-1-yl]oxy]-N,N,N-trimethylethanaminium; Choline, salt with 1-thio-β-D-glucopyranose 1-[2-(p-hydroxyphenyl)acetohydroximate] NO-(hydrogen sulfate) (1:1), mono(4-hydroxy-3,5-dimethoxycinnamate) (ester); β-D-Glucopyranose, 1-thio-, 1-[4-hydroxy-N-(sulfooxy)benzeneethanimidate], ion(1-), 2-[[3-(4-hydroxy-3,5-dimethoxyphenyl)-1-oxo-2-propenyl]oxy]-N,N,N-trimethylethanaminium; Glucopyranose, 1-thio-, 1-[2-(p-hydroxyphenyl)acetohydroximate], NO-(hydrogen sulfate) ion(1-), choline, mono(4-hydroxy-3,5-dimethoxycinnamate) ester, β-D-; Ethanaminium, 2-[[3-(4-hydroxy-3,5-dimethoxyphenyl)-1-oxo-2-propenyl]oxy]-N,N,N-trimethyl-, salt with 1-thio-β-D-glucopyranose 1-[4-hydroxy-N-(sulfooxy)benzeneethanimidate] (1:1). Grades: 95%. CAS No. 20196-67-2. Molecular formula: C14H19NO10S2. Mole weight: 425.433.
Sinapine
Sinapine is an alkaloid isolated from cruciferous species with antioxidant and radio-protective activities. Alternative Names: Sinapoylcholine; O-sinapoylcholine. Grades: 98%. CAS No. 18696-26-9. Molecular formula: C16H24NO5+. Mole weight: 310.36.
Sinapine thiocyanate
Sinapine thiocyanate can be extracted from the seeds of Raphanus sativus L. Uses: Antioxidant / antihypertensive. Alternative Names: ethanaminium, 2-\\3-(4-hydroxy-3,5-dimethoxyphenyl)-1-oxo-2-propenyl\oxy\-n,n,n-trimethyl-, thiocyanate (9ci); 2-((3-(4-Hydroxy-2,5-diMethoxyphenyl)acryloyl)oxy)-N,N,N-triMethylethanaMiniuM thiocyanate. Grades: >98%. CAS No. 7431-77-8. Molecular formula: C16H24NO5.CNS. Mole weight: 368.45.
SINIGRIN MONOHYDRATE
Sinigrin exerts important anti-proliferative activities in carcinogen-induced hepatocarcinogenesis in rats, and highlight the potential of Sinigrin as an anti-cancer agent for liver cancer. Alternative Names: sinigrin monohydrate; 1-S-[(1E)-N-(sulfonatooxy)but-3-enimidoyl]-1-thio-beta-D-glucopyranose. Grades: >98%. CAS No. 64550-88-5. Molecular formula: C10H16KNO9S2.
Siramesine hydrochloride
Siramesine hydrochloride is the hydrochloride salt form of Siramesine. Siramesine is a selective sigma-2 receptor agonist with potent anticancer activity in vivo. It was originally devevloped for treating depressant. Alternative Names: Siramesine (hydrochloride); Siramesine HCl; Lu-28-179; Lu 28-179; Lu28-179; Lu-28179; Lu 28179; Lu28179. CAS No. 224177-60-0. Molecular formula: C30H32ClFN2O. Mole weight: 491.04.
siRNA Negative Control
siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Alternative Names: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ).
Sirolimus oxepane isomer
An impurity of Rapamycin. Rapamycin is a macrolide compound. It inhibits activation of T cells and B cells by reducing the production of interleukin-2. Rapamycin can be used to coat coronary stents and prevent organ transplant rejection. Alternative Names: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,28R,34aS)-9,10,12,13,14,21,22,23,24,25,26,28,32,33,34,34a-Hexadecahydro-9,28-dihydroxy-3-[(1R)-2-[(1S,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,28-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclohentriacontine-1,5,11,27,29(4H,6H,31H)-pentone; Rapamycin, 9,14-deepoxy-15-deoxo-14-deoxy-9,15-epoxy-15-hydroxy-14-oxo-, (15R)-; (15R)-9,14-Deepoxy-15-deoxo-14-deoxy-9,15-epoxy-15-hydroxy-14-oxorapamycin; Rapamycin Impurity 1. Grades: >95%. CAS No. 144293-63-0. Molecular formula: C51H79NO13. Mole weight: 914.19.
Sirolimus triketone isomer
Sirolimus triketone isomer is an impurity of Rapamycin, which is a macrolide compound used to coat coronary stents and prevent organ transplant rejection. Alternative Names: Sirolimus isomer A; Rapamycin isomer A; 10,21-Dimethoxy-6,8,12,14,20,26-hexamethyl-9,10,13,14,21,22,23,24,25,26,32,33,34,34a-tetradecahydro-3H-pyrido[2,1-c][1]oxa[4]azacyclohentriacontine-1,5,11,27,28,29(4H,6H,12H,31H)-hexaone. Grades: 85%. Molecular formula: C51H79NO13. Mole weight: 914.17.
Sirpiglenastat
Sirpiglenastat is a glutaminase inhibitor. Alternative Names: sirpiglenastatum; DRP-104; DRP104. Grades: 95%. CAS No. 2079939-05-0. Molecular formula: C22H27N5O5. Mole weight: 441.5.
Sitagliptin EDA impurity
Sitagliptin EDA impurity is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for the treatment of diabetes mellitus type 2. Alternative Names: Benzenebutanamide, N,N'-1,2-ethanediylbis[β-amino-2,4,5-trifluoro-, (βR,β'R)-. Grades: > 95%. CAS No. 1608491-98-0. Molecular formula: C22H24F6N4O2. Mole weight: 490.44.
Sitagliptin Enamine Impurity
Sitagliptin Enamine Impurity is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: (2Z)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)but-2-en-2-amine; 2,3-Desdihydrogen rac-Sitagliptin; (2Z)-3-Amino-1-[5,6-dihydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazin-7(8H)-yl]-4-(2,4,5-trifluorophenyl)-2-buten-1-one. Grades: >98%. CAS No. 767340-03-4. Molecular formula: C16H13F6N5O. Mole weight: 405.3.
Sitagliptin EP Impurity A Phosphate
Sitagliptin EP Impurity A Phosphate is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin S-Isomer Phosphate; ent-Sitagliptin Phosphate; (S)-Sitagliptin Phosphate; 7-[(3S)-3-Amino-1-oxo-4-(2,4,5-trifluorophenyl)butyl]-5,6,7,8-tetrahydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazine Phosphate. Grades: >95%. CAS No. 823817-58-9. Molecular formula: C16H15F6N5O.H3PO4. Mole weight: 505.31.
Sitagliptin EP Impurity B
Sitagliptin EP Impurity B is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin Analog 13; 4-Desfluoro Sitagliptin; (R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,5-difluorophenyl)butan-2-amine. Grades: > 95%. CAS No. 486460-31-5. Molecular formula: C16H16F5N5O. Mole weight: 389.32.
Sitagliptin EP Impurity C
Sitagliptin EP Impurity C is a impurity of Sitagliptin. Sitagliptin is an dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: 5-Desfluoro Sitagliptin; (R)-3-amino-4-(2,4-difluorophenyl)-1-(3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl)butan-1-one. CAS No. 945261-48-3. Molecular formula: C16H16F5N5O. Mole weight: 389.32.
Sitagliptin FP Impurity B
Sitagliptin FP Impurity B is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin Triazecine Impurity; Sitagliptin Triazecine Analog; (R)-10-(2,4,5-trifluorobenzyl)-3-(trifluoromethyl)-6,7,10,11-tetrahydro-[1,2,4]triazolo[3,4-c][1,4,7]triazecine-8,12(5H,9H)-dione. Grades: >95%. CAS No. 2088771-61-1. Molecular formula: C16H13F6N5O2. Mole weight: 421.3.
Sitagliptin Fumarate Adduct (Mixture of Diastereomers)
Sitagliptin Fumarate Adduct is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin Tablets EP Impurity FP-A; Sitagliptin FP Impurity A; N-[(1R)-3-[5,6-Dihydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazin-7(8H)-yl]-3-oxo-1-[(2,4,5-trifluorophenyl)methyl]propyl]-L-Aspartic acid; Sitagliptin Maleate adduct. Grades: 95%. CAS No. 2088771-60-0. Molecular formula: C20H19F6N5O5. Mole weight: 523.39.
Sitagliptin hydrochloride monohydrate
Sitagliptin hydrochloride monohydrate is a hydrochloride form of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin monohydrochloride monohydrate; Sitagliptin hydrochloride hydrate. CAS No. 862156-92-1. Molecular formula: C16H18ClF6N5O2. Mole weight: 461.79.
Sitagliptin Impurity 18
Sitagliptin Impurity 18 is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin N-Boc Impurity; (R)-tert-Butyl (4-oxo-4-(3-(trifluoromethyl)-5,6-dihydro-[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl)-1-(2,4,5-trifluorophenyl)butan-2-yl)carbamate; N-[(1R)-3-[5,6-Dihydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazin-7(8H)-yl]-3-oxo-1-[(2,4,5-trifluorophenyl)methyl]propyl]carbamic Acid 1,1-Dimethylethyl Ester. Grades: >95%. CAS No. 486460-23-5. Molecular formula: C21H23F6N5O3. Mole weight: 507.43.
Sitagliptin Impurity 20 Hydrochloride
Sitagliptin Impurity 20 Hydrochloride is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: 5,6,7,8-Tetrahydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazine Monohydrochloride; Sitagliptin Triazole Hydrochloride. Grades: >98%. CAS No. 762240-92-6. Molecular formula: C6H7F3N4.HCl. Mole weight: 228.6.
Sitagliptin Impurity 28
Sitagliptin Impurity 28 is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: 3-({4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-yl}amino)-1-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-4-(2,4,5-trifluorophenyl)but-2-en-1-one. CAS No. 898543-70-9. Molecular formula: C32H25F12N9O2. Mole weight: 795.58.
Sitagliptin Impurity 40 HCl
Sitagliptin Impurity 40 HCl is an impurity of Sitagliptin. Sitagliptin is an dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: methyl (R)-3-amino-4-(2,4,5-trifluorophenyl)butanoate, hydrochloride (1:1); (R)-Methyl 3-amino-4-(2,4,5-trifluorophenyl)butanoate hydrochloride; Methyl (R)-beta-Amino-2,4,5-F3-benzenebutanoate HCl. CAS No. 1374985-05-3. Molecular formula: C11H12F3NO2.HCl. Mole weight: 283.67.
Sitagliptin phenylcrotonyl analog
Sitagliptin phenylcrotonyl analog is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for the treatment of diabetes mellitus type 2. Alternative Names: Sitagliptin Deamino Impurity 1; 3-Desamino-2,3-dehydro Sitagliptin; (2E)-1-[5,6-Dihydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazin-7(8H)-yl]-4-(2,4,5-trifluorophenyl)-2-buten-1-one. Grades: >90%. CAS No. 1253056-18-6. Molecular formula: C16H12F6N4O. Mole weight: 390.28.
Sitagliptin Phosphate Monohydrate
Sitagliptin Phosphate Monohydrate is the phosphate salt form of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for treatment of diabetes mellitus type 2. Alternative Names: MK-0431 phosphate monohydrate; 7-[(3R)-3-amino-1-oxo-4-(2,4,5-trifluorophenyl)butyl]-5,6,7,8-tetrahydro-3-(trifluoromethyl)-1,2,4-triazolo[4,3-a]pyrazine phosphate monohydrate. Grades: >98%. CAS No. 654671-77-9. Molecular formula: C16H20F6N5O6P. Mole weight: 523.32.
Sitagliptin styrylacetyl analog
Sitagliptin styrylacetyl analog is an impurity of Sitagliptin. Sitagliptin is a dipeptidyl peptidase-4 (DPP-4) inhibitor for the treatment of diabetes mellitus type 2. Alternative Names: 3-Desamino-3,4-dehydro Sitagliptin; (3E)-1-[3-(Trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-4-(2,4,5-trifluorophenyl)but-3-en-1-one. Grades: >95%. CAS No. 1803026-58-5. Molecular formula: C16H12F6N4O. Mole weight: 390.28.
Sitagliptin Triazecine Analog
Sitagliptin Triazecine Analog is an impurity of Sitagliptin. Sitagliptin is a dipeptidylpeptidase-4 (DPP-4) inhibitor used in the treatment of diabetes mellitus type 2. Alternative Names: 10-(2,4,5-Trifluorobenzyl)-3-(trifluoromethyl)-6,7,10,11-tetrahydro-[1,2,4]triazolo[3,4-c][1,4,7]triazecine-8,12(5H,9H)-dione. Grades: > 95%. CAS No. 2805078-75-3. Molecular formula: C16H13F6N5O2. Mole weight: 421.30.
Sitaxentan sodium
Sitaxentan sodium inhibits ET-1-induced stimulation of phosphoinositide turnover with a Ki of 0.69 nM and a pA2 of 8.0. Alternative Names: TBC-11251; TBC 11251; TBC11251. Grades: >98%. CAS No. 210421-74-2. Molecular formula: C18H14ClN2O6S2.Na. Mole weight: 476.89.
Sitostanol-d7
An isotope labelled Stigmastanol (sitostanol). Stigmastanol (sitostanol) is a phytosterol found in a variety of plant sources. Similar to sterol esters and stanol esters, stigmastanol inhibits the absorption of cholesterol from the diet. Alternative Names: 5α-Cholestan-24(RS)-ethyl-3β-ol-25,26,26,26,27,27,27-d7. Grades: > 95%. Molecular formula: C29H45OD7. Mole weight: 423.77.
Sivelestat
Sivelestat is a competitive human neutrophil elastase (HNE) inhibitor (IC50 = 44 nM, Ki=0.2 μM). It also inhibits leukocyte elastase obtained from rabbit, rat, hamster and mouse (IC50 = 19 to 49 nM). However, it does not inhibit trypsin, thrombin, plasmin, plasma kallikrein, pancreas kallikrein, chymotrypsin and cathepsin G even at 100 μM. In in-vivo studies, it suppressed lung hemorrhage in hamster (ID50 = 82 μg/kg) by intratracheal administration and increase of skin capillary permeability in guinea pig (ID50 = 9.6 mg/kg) by intravenous administration, both of which were induced by human neutrophil elastase. Alternative Names: EI546; EI 546; EI-546; LY544349; LY 544349; LY-544349; ONO5046; ONO-5046; ONO 5046. Grades: >98%. CAS No. 127373-66-4. Molecular formula: C20H22N2O7S. Mole weight: 434.46.
Sivelestat sodium tetrahydrate
Sivelestat is a competitive human neutrophil elastase (HNE) inhibitor (IC50 = 44 nM, Ki=0.2 μM). It also inhibits leukocyte elastase obtained from rabbit, rat, hamster and mouse (IC50 = 19 to 49 nM). However, it does not inhibit trypsin, thrombin, plasmin, plasma kallikrein, pancreas kallikrein, chymotrypsin and cathepsin G even at 100 μM. In in-vivo studies, it suppressed lung hemorrhage in hamster (ID50 = 82 μg/kg) by intratracheal administration and increase of skin capillary permeability in guinea pig (ID50 = 9.6 mg/kg) by intravenous administration, both of which were induced by human neutrophil elastase. Uses: Serine proteinase inhibitors. Alternative Names: EI546 sodium tetrahydrate; EI 546 sodium tetrahydrate; EI-546 sodium tetrahydrate; LY544349 sodium tetrahydrate; LY 544349 sodium tetrahydrate; LY-544349 sodium tetrahydrate; ONO5046 sodium tetrahydrate; ONO 5046 sodium tetrahydrate; ONO-5046 sodium tetrahydrate. Grades: >98%. CAS No. 201677-61-4. Molecular formula: C20H29N2NaO11S. Mole weight: 528.51.
SJG-136
SJG-136 is a DNA cross-linking agent, with an XL50 of 45 nM for pBR322 DNA. SJG-136 has potent antitumor activity. Alternative Names: SJG 136; SJG136; SJG-136; SP-2001; SP2001; SP 2001; BN 2629; BN2629; BN-2629; SG2000; SG 2000; SG-2000; NSC 694501; NSC694501; NSC-694501. Grades: >98.0%. CAS No. 232931-57-6. Molecular formula: C31H32N4O6. Mole weight: 556.61.
SKF 89976A
SKF 89976A hydrochloride is a potent GABA transporter inhibitor with selectivity for GAT-1 (IC50 = 0.13, 550, 944 and 7210 μM for hGAT-1, rGAT-2, hGAT-3 and hBGT-1, respectively). SKF 89976A inhibits transport current competitively (Ki = 7 μM) and transmitter-gated current non-competitively (Ki = 0.03 nM). SKF 89976A can pass the blood-brain barrier following systemic administration. Alternative Names: 1-(4,4-Diphenyl-3-butenyl)-3-piperidinecarboxylic acid hydrochloride; 3-Piperidinecarboxylic acid, 1-(4,4-diphenyl-3-buten-1-yl)-, hydrochloride (1:1); 3-Piperidinecarboxylic acid, 1-(4,4-diphenyl-3-butenyl)-, monohydrochloride; 1-(4,4-Diphenylbut-3-en-1-yl)piperidine-3-carboxylic acid hydrochloride; SKF89976A; SKF-89976A; SKF 89976 hydrochloride; SKF89976 hydrochloride; SKF-89976 hydrochloride. Grades: ≥99% by HPLC. CAS No. 85375-15-1. Molecular formula: C22H25NO2.HCl. Mole weight: 371.91.
SKI II
2-(p-Hydroxyanilino)-4-(p-chlorophenyl)thiazole (SK1-II) is a cell permeable, potent, and specific inhibitor of sphingosine kinase (IC50 = 0.5 μM). The compound does not bind to the ATP-binding site and does not affect the kinase activities of hERK2, hPI3K, or hPKCα at concentrations up to 60 μM. SK1-II showed anti-tumor properties, inducing apoptosis in a number of cell lines including those that express Pgp or MRP1 drug-transport proteins. Alternative Names: SphK-I2; SKI-II; SKI II. Sphingosine kinase inhibitor II. Grades: >98%. CAS No. 312636-16-1. Molecular formula: C15H11ClN2OS. Mole weight: 302.78.
SKL 2001
SKL 2001 is a Wnt/β-catenin signaling pathway agonist that modulates the differentiation of mesenchumal stem cells. It upregulates the β-catenin responsive transcription via increasing the intracellular β-catenin protein level, and inhibits the phosphorylation of β-catenin at residues Ser33/37/Thr41 and Ser45. Alternative Names: SKL-2001; SKL 2001; SKL2001; Wnt Agonist II; 5-(furan-2-yl)-N-(3-imidazol-1-ylpropyl)-1,2-oxazole-3-carboxamide. Grades: 99%. CAS No. 909089-13-0. Molecular formula: C14H14N4O3. Mole weight: 286.29.
SKQ1
SKQ1, also known as plastoquinonyl decyltriphenyl phosphonium or PDTP, is a potent mitochondria-targeted antioxidant. SKQ1 is also an API (active pharmaceutical ingredient) for making eye drop drug called Visomitin. Alternative Names: SKQ1; SKQ 1; SKQ-1; PDTP; Plastoquinonyl decyltriphenyl phosphonium bromide; Visomitin. Grades: 95%. CAS No. 934826-68-3. Molecular formula: C36H42BrO2P. Mole weight: 617.61.
Skullcapflavone II
Skullcapflavone II is a flavonoid isolated from Scutellariae radix with anti-inflammatory and anticancer activities. Alternative Names: Scullcapflavone II; Neobaicalein; 5,2'-Dihydroxy-6,7,8,6'-tetramethoxyflavone. Grades: 0.98. CAS No. 55084-08-7. Molecular formula: C19H18O8. Mole weight: 374.4.
S-Lactoylglutathione. CAS No. 54398-03-7. Mole weight: 379.39.
SLP120701 HCl
The hydrochloride salt form of SLP120701, an oxadiazol derivative, has been found to be a Sphk inhibitor and could probably be useful in studies of some cancer, fibrosis, and sickle cell diseases. Uses: The hydrochloride salt form of slp120701 has been found to be a sphk inhibitor and could probably be useful in studies of some cancer, fibrosis, and sickle cell diseases. Alternative Names: (S)-2-(3-(4-octylphenyl)-1,2,4-oxadiazol-5-yl)azetidine-1-carboximidamide hydrochloride; SLP120701; SLP-120701; SLP120701. Grades: 98%. CAS No. 1449768-46-0. Molecular formula: C20H30ClN5O. Mole weight: 391.94.
SLR080811 HCl
The hydrochloride salt form of SLR080811, an oxadiazol derivative, has been found to be a SphK inhibitor and could probably be useful in studies of some cancer, fibrosis, and sickle cell diseases. Uses: Slr080811 hcl has been found to be a sphk inhibitor and could probably be useful in studies of some cancer, fibrosis, and sickle cell diseases. Alternative Names: SLR080811 HCl; SLR 080811 HCl; SLR-080811 HCl; SLR080811 hydrochloride; SLR 080811 HCl; 1-Pyrrolidinecarboximidamide, 2-[3-(4-octylphenyl)-1,2,4-oxadiazol-5-yl]-, hydrochloride. Grades: 98%. CAS No. 1449768-36-8. Molecular formula: C21H32ClN5O. Mole weight: 369.50.
SM-102
SM-102 is an ionizable amino lipid that has been used in combination with other lipids in the formation of lipid nanoparticles which is used in the Moderna COVID-19 vaccine. Alternative Names: 1-Octylnonyl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate. Grades: 95%. CAS No. 2089251-47-6. Molecular formula: C44H87NO5. Mole weight: 710.16.
Smac-N7 Peptide
Smac-N7 Peptide. Alternative Names: H-AVPIAQK-OH; H-ALA-VAL-PRO-ILE-ALA-GLN-LYS-OH; AVPIAQK; SMAC-N7 PEPTIDE; SMAC N7 PROTEIN; SMAC PROTEIN (1-7) (HUMAN, MOUSE). Grades: 95%. CAS No. 401913-57-3. Molecular formula: C33H59N9O9.
Smectite clay minerals
This Clay is a natural multifuncional black color clay. Perfect for men cosmetics, with oil control and anti-dandruff benefits. It can also be used as an exfoliant, facial gel, liquid soap, bars soap, shampoo for oily hair, and masks. Clay Black has naturally copper, selenium, magnesium, zinc and manganese that help the skin nutrition and in maintain the skin healthy. Uses: Hair care soap body care face care. Alternative Names: SMECTITE; VAN GEL B; VAN GEL C; VAN GEL ES; VAN GEL O; Smectite-group minerals; Alminosillicic acid,magnesium sillicate; magnesium aluminosilicate (smectite). Grades: 95%. CAS No. 12199-37-0.
S-Methyl-N,N-diethyldithiocarbamate Sulfoxide
S-Methyl-N,N-diethyldithiocarbamate Sulfoxide. Uses: A metabolite of disulfiram (d493640). an inhibitor of human mitochondrial aldehyde dehydrogenase. Alternative Names: N,N-Diethyl-1-(methylsulfinyl)methanethioamide. CAS No. 145195-14-8. Molecular formula: C6H13NOS2. Mole weight: 179.30.
S-Methyl N,N-Diethylthiocarbamate
S-Methyl N,N-Diethylthiocarbamate (CAS# 37174-63-3 ) is a useful research chemical. Alternative Names: S-Methyl diethylthiocarbamate; Diethyl-carbamothioic Acid S-Methyl Ester; Diethylthio-carbamic Acid S-Methyl Ester. CAS No. 37174-63-3. Molecular formula: C6H13NO5S. Mole weight: 147.24.
S-Methyl thiobutanoate
S-Methyl thiobutanoate (CAS# 2432-51-1 ) is a useful research chemical. Alternative Names: S-methyl butanethioate. Grades: 95 %. CAS No. 2432-51-1. Molecular formula: C5H10OS. Mole weight: 118.20.
SN-38 Glucuronide
A metabolite of Irinotecan. Alternative Names: 7-Ethyl-10-hydroxy-camptothecin-10-O-b-Dglucuronide; (4S)-4,11-Diethyl-3,4,12,14-tetrahydro-4-hydroxy-3,14-dioxo-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinolin-9-yl b-D-glucopyranosiduronic acid. Grades: > 95%. CAS No. 121080-63-5. Molecular formula: C28H28N2O11. Mole weight: 568.53.
SNARF-1, acetate, SE
SNARF-1, acetate, SE is an orange-red fluorescent dye used for long-term tracing of mixed cells. Alternative Names: 5-(6)-Carboxy RhodFluor, Acetate, Succinimidyl Ester. Molecular formula: C33H24N2O9. Mole weight: 592.56.
SNC 162
SNC 162 is a potent and selective non-peptide δ-opioid receptor agonist (Ki = 0.63 nM), displaying > 8000-fold selectivity over μ-opioid receptors. SNC 162 is centrally active following systemic administration in vivo. Alternative Names: SNC 162; SNC162; SNC-162; 4-[(S)-[(2S,5R)-2,5-Dimethyl-4-(2-propenyl)-1-piperazinyl]phenylmethyl]-N,N-diethylbenzamide. Grades: ≥99% by HPLC. CAS No. 178803-51-5. Molecular formula: C27H37N3O. Mole weight: 419.61.
SNC 80
SNC 80 is a potent and non-peptide δ-opioid agonist, displaying 2000-fold selectivity over μ-opioid receptors. SNC 80 exhibits antinociceptive as well as pro-convulsant effects in vivo. Alternative Names: SNC80; SNC-80; SNC80; (+)-4-[(αR)-α-((2S,5R)-4-Allyl-2,5-dimethyl-1-piperazinyl)-3-methoxybenzyl]-N,N-diethylbenzamide; 4-[(R)-[(2S,5R)-2,5-dimethyl-4-prop-2-enylpiperazin-1-yl]-(3-methoxyphenyl)methyl]-N,N-diethylbenzamide. Grades: ≥98% by HPLC. CAS No. 156727-74-1. Molecular formula: C28H39N3O2. Mole weight: 449.64.
SNDX-5613
SNDX-5613 is a potent and specific Menin-MLL inhibitor. It can be used to study MLL rearrangement (MLL-r) acute leukemia, including acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML). Alternative Names: SNDX 5613; SNDX5613. Grades: ≥98% by HPLC. CAS No. 2169919-21-3. Molecular formula: C32H47FN6O4S. Mole weight: 630.82.
SNIPER(BRD)-1
SNIPER(BRD)-1, consists of an IAP antagonist LCL-161 derivative and a BET inhibitor, (+)-JQ-1, connected by a linker. SNIPER(BRD)-1 induces the degradation of BRD4 via the ubiquitin-proteasome pathway. SNIPER(BRD)-1 also degrades cIAP1 , cIAP2 and XIAP with IC50s of 6.8 nM, 17 nM, and 49nM, respectively[1]. Alternative Names: (S)-N-((S)-2-((S)-2-(4-(3-((1-((S)-4-(4-chlorophenyl)-2,3,9-trimethyl-6H-thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepin-6-yl)-2-oxo-6,9,12-trioxa-3-azatetradecan-14-yl)oxy)benzoyl)thiazol-2-yl)pyrrolidin-1-yl)-1-cyclohexyl-2-oxoethyl)-2-(methylamino)propanamide; 6H-Thieno[3,2-f][1,2,4]triazolo[4,3-a][1,4]diazepine-6-acetamide, 4-(4-chlorophenyl)-α-[2-[2-[2-[2-[3-[[2-[(2S)-1-[(2S)-2-cyclohexyl-2-[[(2S)-2-(methylamino)-1-oxopropyl]amino]acetyl]-2-pyrrolidinyl]-4-thiazolyl]carbonyl]phenoxy]ethoxy]ethoxy]ethoxy]ethyl]-2,3,9-trimethyl-, (6S)-; SNIPER(BRD4)-1. CAS No. 2095244-54-3. Molecular formula: C53H66ClN9O8S2. Mole weight: 1056.73.
S-(N-methylcarbamoyl)glutathione
S-(N-methylcarbamoyl)glutathione. Uses: A metabolite of the investigational antitumor agent n-methylformamide (nmf). Alternative Names: N-[N-L-γ-Glutamyl-S-[(methylamino)carbonyl]-L-cysteinyl]glycine. Grades: ≥95%. CAS No. 38126-73-7. Molecular formula: C12H20N4O7S. Mole weight: 364.37.
S(-)-N,N-dimethyl-1-ferrocenylethylamine
S(-)-N,N-dimethyl-1-ferrocenylethylamine (CAS# 31886-57-4 ) is a useful research chemical. Alternative Names: (S)-(-)-[1-(DIMETHYLAMINO)ETHYL]FERROCENE; (S)-(-)-N,N-DIMETHYL-1-FERROCENYLETHYLAMINE; (S)-(-)-N,N-Dimethyl-1-ferroceneylethylamine; (S)-alpha-(N,N-Dimethylamino)ethylferrocene,; (S)-(-)-N N-DIMETHYL-1-FERROCENYL- &; Ferrocene, (1S)-1-(dimethylamino)ethy. Grades: > 95.0 % (GC). CAS No. 31886-57-4. Molecular formula: C14H19FeN. Mole weight: 257.15.
SO1861
SO1861, a naturally occurring triterpene saponin with endosomal escape properties isolated from Saponaria officinalis L., has been described as additive agent to enhance transfection efficiency (sapofection). Grades: ≥90%. CAS No. 1932690-79-3. Molecular formula: C83H130O46. Mole weight: 1863.90.
Soapnut Extract
Soapnut Extract is a natural non-ionic surfactant and can be used as skin conditioning agent. It has strong detergency and shows antibacterial, pollution-free, antibacterial, soft skin properties. It also has anti-inflammatory, anti-oxidant, scavenging free radicals, and anti-coagulation effects. It is usually used in the preparation of hand sanitizer, shower gel, shampoo, soap, cosmetics and other washing chemicals. Alternative Names: Chinese Soapberry Seed P.E.; SAPINDUS MUKUROSSI FRUIT EXTRACT. Grades: UV 40%-80%. CAS No. 223748-41-2. Molecular formula: Mixture.
Sobetirome
Sobetirome selectively binds to and activates TRbeta over TRalpha and this receptor selectivity led to the hypothesis that sobetirome would lower cholesterol through activation of liver TRbeta without stimulating cardiac function through TRalpha activation in the heart. The tissue selective thyromimetic properties of sobetirome have been demonstrated in numerous animal models, which led to its clinical development as a novel cholesterol-lowering agent. Treatment of hypercholestemia obesity, and thyroid proliferative disorders. Alternative Names: GC-1; GC1; GC 1; QRX-431; QRX 431; QRX431; Acetic acid, 2-[4-[[4-hydroxy-3-(1-methylethyl)phenyl]methyl]-3,5-dimethylphenoxy]-. Grades: 98%. CAS No. 211110-63-3. Molecular formula: C20H24O4. Mole weight: 328.40.
Soda Ash
Soda Ash. Uses: Filter aid (sugar refining, wine, beer, drinks, etc.); and activated carbon combination can improve the bleaching effect and the role of adsorption resin. amount as the production needs of the (gb 2760-96 provides for the food processing aids). Grades: 0.95. CAS No. 68855-54-9. Molecular formula: O2 Si. Mole weight: 60.084.
Sodelglitazar
Sodelglitazar. Alternative Names: SODELGLITAZAR; 2-[4-[[[2-[2-Fluoro-4-(trifluoromethyl)phenyl]-4-methyl-1,3-thiazol-5-yl]methyl]sulfanyl]-2-methylphenoxy]-2-methylpropanoic acid. CAS No. 447406-78-2. Molecular formula: C23H21F4NO3S2. Mole weight: 499.54.
S-(+)-O-Desmethyl-Venlafaxine
S-(+)-O-Desmethyl-Venlafaxine is a metabolite of Venlafaxine. Venlafaxine is a serotonin-norepinephrine reuptake inhibitor (SNRI) that is used as an antidepressant. According to different doses, it effects on serotonergic transmission, noradrenergic systems and dopaminergic neurotransmission. Venlafaxine is commonly used to treat depression, general anxiety disorder, social phobia, panic disorder, and vasomotor symptoms. Alternative Names: (S)-(+)-4-[2-(Dimethylamino)-1-(1-hydroxycyclo-hexyl)ethyl]phenol. CAS No. 142761-12-4. Molecular formula: C16H25NO2. Mole weight: 263.38.
Sodium 1,5-naphthalenedisulfonate dibasic
Sodium 1,5-naphthalenedisulfonate dibasic (CAS# 1655-29-4) is a petroleum disulfonates in crude oil; It is used in the synthesis of Levobunolol Hydrochloride; Also, it is capable of recycling wastewater. Alternative Names: disodium;naphthalene-1,5-disulfonate. Grades: Techincal grade. CAS No. 1655-29-4. Molecular formula: C10H6Na2O6S2. Mole weight: 332.26.
Sodium 1-decanesulfonate
Sodium 1-decanesulfonate. Uses: Alkane sulfonates: used in liquid detergents, concentrated shampoos, textile and leather auxiliaries (mercerising), metal cleaning preparations, steam jets, and pickling bathes. Alternative Names: sodium decane-1-sulfonate; 1-Decanesulfonic acid sodium salt; sodium decylsulfonate. Grades: 98%. CAS No. 13419-61-9. Molecular formula: C10H21NaO3S. Mole weight: 244.33.
Sodium 1-dodecanesulfonate
Sodium 1-dodecanesulfonate (CAS# 2386-53-0) is a useful research chemical. Uses: Alkane sulfonates: used in liquid detergents, concentrated shampoos, textile and leather auxiliaries (mercerising), metal cleaning preparations, steam jets, and pickling bathes. Alternative Names: sodium;dodecane-1-sulfonate. Grades: > 98.0 % (T). CAS No. 2386-53-0. Molecular formula: C12H25NaO3S. Mole weight: 272.38.