MedChemExpress (MCE) offers a wide range of high-quality research chemicals and biochemicals (novel life-science reagents, reference compounds and natural compounds) for scientific use.
×
Product
Description
Suppliers Website
Benzophenonetetracarboxylic acid
Benzophenonetetracarboxylic acid (3,3',4,4'-Benzophenonetetracarboxylic acid) is particularly useful in the preparation of high performance polyimides and also useful as curing agents for epoxy resins[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 3,3',4,4'-Benzophenonetetracarboxylic acid. CAS No. 2479-49-4. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 50 mg; 100 mg. Product ID: HY-100511.
(Benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate (Benzotriazole-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate) is a peptide coupling reagent and BOP analog. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate promotes the reaction of amino and carboxyl groups to form peptide bonds. (Benzotriazol-1-yloxy)tripyrrolidinophosphonium hexafluorophosphate can be used in the synthesis of peptide compounds[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Benzotriazole-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate. CAS No. 128625-52-5. Pack Sizes: 10 mM * 1 mL in DMSO; 25 g; 50 g; 100 g; 250 g; 500 g. Product ID: HY-D0177.
Benzthiazide
Benzthiazide is a long-acting diuretic[1] and a hypertension agent. Benzthiazide is an inhibitor of carbonic anhydrase 9 (CA9), with Kis of 8.0, 8.8 and 10 nM for CA9, CA2 and CA1, respectively. Benzthiazide also suppresses proliferation of cancer cells[2]. Uses: Scientific research. Category: Signaling pathways. CAS No. 91-33-8. Pack Sizes: 10 mM * 1 mL in DMSO; 100 mg; 500 mg. Product ID: HY-B1424.
Benztropine
Benztropine (Benzatropine; Benzotropine) is an orally active and BBB-permeable centrally acting anticholinergic agent that can be used for Parkinson's disease research[1]. Benztropine is an anti-histamine agent and a dopamine re-uptake inhibitor. Benztropine is also a human D2 dopamine receptor allosteric antagonist. Benztropine mesylate also has anti-CSCs (cancer stem cells) effects[2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Benzatropine; Benzotropine. CAS No. 86-13-5. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-B0520.
Benzydamine hydrochloride
Benzydamine hydrochloride is an orally administered prostaglandin synthesis inhibitor that has anti-inflammatory, analgesic, antipyretic, and antibacterial properties. Benzydamine hydrochloride can inhibit TNF-α, stabilize cell membranes, and reduce oxidative stress within cells[1][2][3]. Uses: Scientific research. Category: Signaling pathways. CAS No. 132-69-4. Pack Sizes: 10 mM * 1 mL in Water; 100 mg. Product ID: HY-30235A.
Benzyl (3-aminopropyl)carbamate hydrochloride
Benzyl (3-aminopropyl)carbamate hydrochloride is a PROTAC linker that can be used in the synthesis of PROTACs. Uses: Scientific research. Category: Signaling pathways. CAS No. 17400-34-9. Pack Sizes: 500 mg; 1 g; 5 g; 10 g; 25 g. Product ID: HY-W012016.
Benzylacyclouridine
Benzylacyclouridine (BAU) is a potent and specific inhibitor of uridine phosphorylase, the first enzyme in the catabolism of uridine. Benzylacyclouridine inhibits the metabolic activity of UPP1 and the activity of UPP2. Benzylacyclouridine can modulate the cytotoxic side effects of 5-fluorouracil (5-FU) and its derivatives[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: BAU; 5-Benzylacyclouridine. CAS No. 82857-69-0. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-106406.
Benzyl alcohol
Benzyl alcohol is an aromatic alcohol, a colorless liquid with a mild aromatic odor. Benzyl alcohol is an inhibitor of P450 enzyme. Benzyl alcohol mediated Toll-Like Receptor 4 to reduce the inflammatory response of liver injury in mice[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Benzenemethanol. CAS No. 100-51-6. Pack Sizes: 10 mM * 1 mL in DMSO; 5 g; 10 g. Product ID: HY-B0892.
Benzyl-α-GalNAc
Benzyl-α-GalNAc is a potent O-glycosylation inhibitor. Benzyl-α-GalNAc effectively inhibits the proliferation and activation of LX-2 cells and suppresses the expression of collagen I/III, which has good potential for investigation in liver fibrosis. Benzyl-α-GalNAc also significantly enhances the anti-tumour activity of 5-Fluorouracil (HY-90006) (e.g. pancreatic cancer) by inhibiting O-glycosylation[1][2][3]. Uses: Scientific research. Category: Signaling pathways. CAS No. 3554-93-6. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-129389.
Benzyl benzoate
Benzyl benzoate (Phenylmethyl benzoate) is an orally active anti-scabies agent, acaricide (EC50= 0.06 g/m2) and fungicide. Benzyl benzoate is an angiotensin II (Ang II) inhibitor with antihypertensive effects. Benzyl benzoate can be used in perfumes, pharmaceuticals and the food industry[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Phenylmethyl benzoate. CAS No. 120-51-4. Pack Sizes: 10 mM * 1 mL in DMSO; 500 mg; 1 g; 5 g; 10 g; 25 g; 50 g; 100 g. Product ID: HY-B0935.
Benzyl L-leucyl-L-phenylalaninate TFA
Benzyl L-leucyl-L-phenylalaninate TFA is a peptide[1]. Uses: Scientific research. Category: Peptides. CAS No. 70637-28-4. Pack Sizes: 10 mM * 1 mL in DMSO; 100 mg; 250 mg; 500 mg. Product ID: HY-79862.
Bepirovirsen
Bepirovirsen is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen can be used for the research of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC)[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: ISIS 505358. CAS No. 1403787-62-1. Pack Sizes: 1 mg; 5 mg. Product ID: HY-147217.
Bepirovirsen sodium
Bepirovirsen (ISIS 505358) sodium is an antisense oligonucleotide targeting all HBV messenger RNAs. Bepirovirsen sodium leads to reductions in HBV-derived RNAs, HBV DNA and viral proteins. Bepirovirsen sodium can be used for the research of chronic HBV infection. Bepirovirsen sodium binding site sequence (GCACTTCGCTTCACCTCTGC)[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: ISIS 505358 sodium. CAS No. 2563929-84-8. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-147217A.
Bepranemab
Bepranemab is a humanized IgG4 monoclonal antibody that binds to the central region of tau protein. Bepranemab inhibits the seeding, aggregation of pathological tau protein and the spread of tau pathology to distal brain regions. Bepranemab is applicable to research related to Alzheimer's disease[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: UCB 0107. CAS No. 2244960-75-4. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99471.
Bepridil hydrochloride
Bepridil hydrochloride (CERM 1978) is a calcium channel blocker, with antianginal activity. Uses: Scientific research. Category: Signaling pathways. Alternative Names: CERM 1978. CAS No. 68099-86-5. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-103315.
BER-5
BER-5 is a potent MrgX2 antagonist. BER-5 possess broad-spectrum antagonistic activity against a diverse range of MrgX2 agonists. BER-5 can inhibit Substance P (SP) (HY-P0201)-induced degranulation of LAD2 cells. BER-5 attenuates SP-induced allergic reactions in mice. BER-5 can be used for the study of allergic reactions[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 724709-67-5. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-174452.
Berahyaluronidase alfa
Berahyaluronidase alfa (ALT-B4) is a recombinant hyaluronidase engineered from human hyaluronidase PH20. Berahyaluronidase alfa features favorable structural stability and enzymatic activity, and can be used to enhance drug absorption and dispersion in subcutaneous or intradermal administration[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: ALT-B4. CAS No. 2636716-20-4. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P991212.
Beraprost sodium
Beraprost sodium (TRK-100), a prostacyclin analog, is a stable and orally active proagent of PGI2. Beraprost sodium (TRK-100) is a potent vasodilator, has the potential for pulmonary arterial hypertension treatment through expanding renal vessels, improving microcirculation[1]. Beraprost sodium (TRK-100) is a click chemistry reagent, it contains an Alkyne group and can undergo copper-catalyzed azide-alkyne cycloaddition (CuAAc) with molecules containing Azide groups. Uses: Scientific research. Category: Signaling pathways. Alternative Names: TRK-100; ML 1129 sodium. CAS No. 496807-11-5. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-13569A.
Berberine chloride
Berberine chloride is an alkaloid that acts as an antibiotic. Berberine chloride induces reactive oxygen species (ROS) generation and inhibits DNA topoisomerase. Antineoplastic properties[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Natural Yellow 18 chloride. CAS No. 633-65-8. Pack Sizes: 10 mM * 1 mL in DMSO; 5 g; 10 g; 25 g; 50 g; 100 g. Product ID: HY-18258.
Berberine chloride hydrate
Berberine chloride hydrate (Natural Yellow 18 chloride hydrate) is an alkaloid that acts as an antibiotic. Berberine chloride hydrate induces reactive oxygen species (ROS) generation and inhibits DNA topoisomerase. Antineoplastic properties[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Natural Yellow 18 chloride hydrate. CAS No. 68030-18-2. Pack Sizes: 100 mg; 1 g; 5 g. Product ID: HY-17577.
Berberine sulfate
Berberine sulfate is an alkaloid isolated from the Chinese herbal medicine Huanglian, as an antibiotic. Berberine sulfate induces reactive oxygen species (ROS) generation and inhibits DNA topoisomerase. Berberine sulfate has antineoplastic properties. The sulfate form improves bioavailability[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Natural Yellow 18 sulfate. CAS No. 633-66-9. Pack Sizes: 10 mM * 1 mL in Water; 25 mg; 50 mg; 100 mg; 500 mg; 1 g; 5 g. Product ID: HY-N0716B.
Berberine ursodeoxycholate
Berberine ursodeoxycholate (HTD1801), an ionic salt of Berberine and Ursodeoxycholic acid, is an orally active and potent hypolipidemic agent. Berberine ursodeoxycholate shows significantly great reduction in liver fat content. Berberine ursodeoxycholate has a broad spectrum of metabolic activity. Berberine ursodeoxycholate can be used for the research of hyperlipidemia, non-alcoholic steatohepatitis (NASH) and diabetes[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: HTD1801; BUDCA. CAS No. 1868138-66-2. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-147246.
Berberrubine chloride
Berberrubine chloride is an orally active metabolite of berberine. Berberrubine chloride alleviates mucosal lesions and inflammation in mouse colitis models. Berberrubine chloride has anti-inflammatory, anti-tumor, and antiviral activities[1][1][3]. Uses: Scientific research. Category: Signaling pathways. CAS No. 15401-69-1. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-125850.
Bergamottin
Bergamottin is a potent and competitive CYP1A1 inhibitor with a Ki of 10.703 nM. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 5-Geranoxypsoralen; Bergamotine; Bergaptin. CAS No. 7380-40-7. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg; 10 mg; 25 mg. Product ID: HY-N2194.
Bergapten
Bergapten is a natural anti-inflammatory and anti-tumor agent. Bergapten is inhibitory towards mouse and human CYP isoforms. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 5-Methoxypsoralen. CAS No. 484-20-8. Pack Sizes: 10 mM * 1 mL in DMSO; 500 mg; 1 g; 5 g. Product ID: HY-N0370.
Bergaptol
Bergaptol is an inhibitor of debenzylation of the CYP3A4 enzyme with an IC50 of 24.92 μM. Recent studies have shown that it has anti-proliferative and anti-cancer properties[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 5-Hydroxypsoralen; 4-Hydroxybergapten. CAS No. 486-60-2. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 500 mg. Product ID: HY-76316.
Bergaptol (Standard)
Bergaptol (Standard) is the analytical standard of Bergaptol. This product is intended for research and analytical applications. Bergaptol is an inhibitor of debenzylation of the CYP3A4 enzyme with an IC50 of 24.92 μM. Recent studies have shown that it has anti-proliferative and anti-cancer properties[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 5-Hydroxypsoralen (Standard); 4-Hydroxybergapten (Standard). CAS No. 486-60-2. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-76316R.
Bergenin
Bergenin is a cytoprotective and antioxidative polyphenol found in many medicinal plants. Bergenin has a wide spectrum activities such as hepatoprotective, antiinflammatory, immunomodulatory, antitumor, antiviral, and antifungal properties[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Cuscutin. CAS No. 477-90-7. Pack Sizes: 10 mM * 1 mL in DMSO; 2 mg; 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-N0017.
Bermekimab
Bermekimab (MABp1) is a human monoclonal antibody targeting interleukin-1α(IL-1α). Bermekimab can prevent tumor-related inflammation. Bermekimab can be used in the research of atopic dermatitis[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: MABp1. CAS No. 1401965-15-8. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99246.
Berotralstat dihydrochloride
Berotralstat dihydrochloride (BCX7353 dihydrochloride) is an orally active plasma kallikrein inhibitor. Berotralstat can reduce brain edema and is being studied for glioblastoma and hereditary angioedema[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: BCX7353 dihydrochloride. CAS No. 1809010-52-3. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-109127A.
Bersacapavir
Bersacapavir (JNJ-6379) is an HBV capsid assembly modulator. Bersacapavir exerts a dual mechanism of action against both early and late stages of HBV infection by forming complete genome-free empty capsids and inhibiting de novo synthesis of cccDNA. Bersacapavir inhibits HBV replication. Bersacapavir can be used in the research of hepatitis B[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: JNJ-6379; JNJ-56136379. CAS No. 1638266-40-6. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 250 mg; 1 g. Product ID: HY-109168.
Bersanlimab
Bersanlimab (BI-505) is a fully human monoclonal antibody that targets intercellular adhesion molecule-1 (ICAM-1 or CD54). Bersanlimab has anticancer effects[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: BI-505. CAS No. 1987854-08-9. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99473.
Bersiporocin
Bersiporocin (DWN12088) is an orally effective prolyl-tRNA synthetase (PRS) inhibitor. Bersiporocin exerts antifibrotic effects by inhibiting collagen synthesis. Bersiporocin can be used in the research of pulmonary fibrosis[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: DWN12088. CAS No. 2241808-52-4. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg; 10 mg. Product ID: HY-145555.
Berubicin
Berubicin (RTA 744 free base) is a Doxorubicin (HY-15142A) analog that can cross the blood-brain barrier. Berubicin inhibits P-gp and MRP1-mediated efflux and suppresses glioblastoma multiforme (GBM). Berubicin exerts toxic effects on leukemia cells by activating nuclear factor κB (NF-κB) and induces apoptosis in neuroblastoma cells. Berubicin can be used in the study of tumors related to the nervous system[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: RTA 744 free base; WP 744 free base; WP 769. CAS No. 677017-23-1. Pack Sizes: 1 mg; 5 mg. Product ID: HY-14942.
Berzosertib
Berzosertib (VE-822) is an orally active, CNS-penetrant, and selective ATR kinase inhibitor. Berzosertib blocks ATR kinase activity, abrogates G2/M cell cycle checkpoint, impairs DNA damage repair. Berzosertib induces apoptosis, inhibnits conlony migration, inhibits cell proliferation, and activates cGAS-STING axes in cancer cells. Berzosertib can be used for the research of cancers, such as head and neck squamous cell carcinoma, and colorectal cancer[1][2][3][4][5][6]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: VE-822; VX-970; M6620. CAS No. 1232416-25-9. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 200 mg; 500 mg. Product ID: HY-13902.
Besifloxacin Hydrochloride
Besifloxacin Hydrochloride is a fourth generation fluoroquinolone antibiotic. Besifloxacin Hydrochloride is a DNA gyrase and topoisomerase IV inhibitor. Besifloxacin Hydrochloride has broad-spectrum antibacterial activity, it is effective against Gram-negative and Gram-positive aerobic and anaerobic strains and reduces the incidence of drug resistance. Besifloxacin Hydrochloride has anti-inflammatory activity. Besifloxacin Hydrochloride can be used in bacterial conjunctivitis research[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 405165-61-9. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-17028.
Bestatin
Bestatin is a natural, broad-spectrum, and competitive CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase inhibitor. Bestatin has anticancer effects[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Ubenimex. CAS No. 58970-76-6. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-B0134.
Bestatin hydrochloride
Bestatin hydrochloride is an inhibitor of CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase, used for cancer research. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Ubenimex hydrochloride. CAS No. 65391-42-6. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 500 mg. Product ID: HY-B0134A.
Bestatin (Standard)
Bestatin (Standard) is the analytical standard of Bestatin. This product is intended for research and analytical applications. Bestatin is a natural, broad-spectrum, and competitive CD13 (Aminopeptidase N)/APN and leukotriene A4 hydrolase inhibitor. Bestatin has anticancer effects[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Ubenimex (Standard). CAS No. 58970-76-6. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-B0134R.
Bestim
Bestim (γ-Glu-Trp) is a dipeptide, which exhibits high affinity to murine peritoneal macrophages, thymocytes, and plasma membranes isolated from these cells, with Kds of 3.1, 2.1, 18.6 and 16.7 nM, respectively. Bestim inhibits adenylate cyclase in the membranes of murine macrophages and thymocytes. Bestim exhibits immunomodulatory efficacy[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: γ-Glu-Trp. CAS No. 66471-20-3. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-122357.
β-1,3-Glucan
β-1,3-Glucan (β Glucan) is an orally active polysaccharide composed of glucose polymers. β-1,3-Glucan increase the activity of IKKβ kinase, enhances the production of nitric oxide. β-1,3-Glucan improves resistance to Vibrio harveyi infection. β-1,3-Glucan enhances immune response, promotes blood pressure recovery, reduces lung, kidney and liver damage, inhibits the growth of syngeneic tumors[1][2][3][4][5][6][7][8]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: β Glucan. CAS No. 9051-97-2. Pack Sizes: 100 mg; 500 mg; 1 g. Product ID: HY-W145521.
beta-1, 3-N-Acetylhexaminyltransferase (LgtA)
beta-1, 3-N-Acetylhexaminyltransferase (LgtA) is a glycosyltransferase, is often used in biochemical studies. beta-1, 3-N-Acetylhexaminyltransferase (LgtA) catalyzes the transfer of N-acetylglucosamine from UDP-GlcNAc to N-acetyllactosamine and lactose[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 37277-64-8. Pack Sizes: 100 mU. Product ID: HY-E70044.
β-Ala-Gly-Arg-pNA
β-Ala-Gly-Arg-pNA is a chromogenic substrate of thrombin with pNA a strong absorbance at 405 nm[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 858971-42-3. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P10094.
β-Ala-Lys(AMCA)
β-Ala-Lys (AMCA) is a fluorescently labeled substrate of oligopeptide transporters. β-Ala-Lys (AMCA) acts as a substrate for a variety of bacterial proton-coupled oligopeptide transporters, and is used to label the activity of oligopeptide transporters. Excitation/emission wavelength: 340 nM/460 nM[1][2]. Uses: Scientific research. Category: Signaling pathways. CAS No. 180342-52-3. Pack Sizes: 1 mg; 5 mg. Product ID: HY-D1154.
β-Alanine
β-Alanine is a non-essential amino acid that is shown to be metabolized into carnosine, which functions as an intracellular buffer. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 2-Carboxyethylamine; 3-Aminopropanoic acid. CAS No. 107-95-9. Pack Sizes: 10 mM * 1 mL in Water; 500 mg; 1 g; 2 g; 5 g. Product ID: HY-N0230.
β-Alanine-13C3,15N
β-Alanine-13C3,15N is the 13C- and 15N-labeled β-Alanine. β-Alanine is a non-essential amino acid that is shown to be metabolized into carnosine, which functions as an intracellular buffer. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 2-Carboxyethylamine-13C3,15N; 3-Aminopropanoic acid-13C3,15N. CAS No. 285978-07-6. Pack Sizes: 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-N0230S.
β-Alanine-d4
β-Alanine-d4 is the deuterium labeled β-Alanine. β-Alanine is a non-essential amino acid that is shown to be metabolized into carnosine, which functions as an intracellular buffer. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 2-Carboxyethylamine-d4; 3-Aminopropanoic acid-d4. CAS No. 116173-67-2. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-N0230S2.
β-Alanine (Standard)
β-Alanine (Standard) is the analytical standard of β-Alanine. This product is intended for research and analytical applications. β-Alanine is a non-essential amino acid that is shown to be metabolized into carnosine, which functions as an intracellular buffer. Uses: Scientific research. Category: Signaling pathways. Alternative Names: 2-Carboxyethylamine (Standard); 3-Aminopropanoic acid (Standard). CAS No. 107-95-9. Pack Sizes: 25 mg; 50 mg; 100 mg; 250 mg. Product ID: HY-N0230R.
β-Aminopropionitrile
β-Aminopropionitrile (BAPN) is a specific, irreversible and orally active lysyl oxidase (LOX) inhibitor. β-Aminopropionitrile targets the active site of LOX or LOXL isoenzymes. β-Aminopropionitrile can be used for the study of obesity[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: BAPN. CAS No. 151-18-8. Pack Sizes: 10 mM * 1 mL in DMSO; 500 mg; 1 g; 5 g; 10 g. Product ID: HY-Y1750.
β-Amyloid (1-16)
β-Amyloid (1-16) is a β-Amyloid protein fragment involved in metal binding. Beta-amyloid is a peptide that forms amyloid plaques in the brains of Alzheimer's disease (AD) patients. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Amyloid β-Protein (1-16). CAS No. 131580-10-4. Pack Sizes: 1 mg; 5 mg. Product ID: HY-P1466.
β-Amyloid (12-20)
β-Amyloid (12-20) is a peptide fragment of β-Amyloid. Uses: Scientific research. Category: Signaling pathways. CAS No. 134649-29-9. Pack Sizes: 5 mg; 10 mg. Product ID: HY-P1880.
β-Amyloid (1-37) (human)
β-Amyloid (1-37) (human) correlates moderately with Mini-Mental State Examination (MMSE) scores in Alzheimer disease. β-Amyloid (1-37) (human) possesses an added diagnostic value[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 186359-67-1. Pack Sizes: 1 mg; 5 mg; 10 mg; 25 mg. Product ID: HY-P2283.
β-Amyloid (1-42), human
β-Amyloid (1-42) (Amyloid β-peptide (1-42)), human, a 42-amino acid peptide that has not been treated with HFIP, is a brain-penetrant amyloid protein fragment, which can be used in research on Alzheimer's disease and Downs syndrome. β-Amyloid (1-42), human remaining as a monomer exhibits antioxidant and neuroprotective effects. β-Amyloid (1-42), human, after being monomericized by HFIP and dissolved in DMSO to form the stock solution, on the one hand, can form soluble oligomers (AβOs) when incubated at 4 °C, which have synaptic toxicity and neurotoxicity; on the other hand, it can be incubated at 37 °C to form insoluble fibrils, with lower neurotoxicity, and participating in the oxidative damage process. Aβ42 oligomers bind to various neuronal surface receptors (such as PrPc, mGluR5, NMDA receptors, etc.), triggering oxidative stress, calcium homeostasis imbalance, and synaptic toxicity via activating downstream signaling pathways, leading to neuronal dysfunction and death[1][1][2][3][4][5][6][7]. Uses: Scientific research. Category: Induced disease models products. Alternative Names: Amyloid β-peptide (1-42) (human). CAS No. 107761-42-2. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P1363A.
β-Amyloid (1-42), (rat/mouse)
β-Amyloid (1-42), (rat/mouse) is a 42-aa peptide, shows cytotoxic effect on acute hippocampal slices, and used in the research of Alzheimer's disease. Uses: Scientific research. Category: Induced disease models products. Alternative Names: Amyloid β-peptide (1-42) (rat/mouse). CAS No. 166090-74-0. Pack Sizes: 500 μg; 1 mg; 5 mg; 10 mg. Product ID: HY-P1388.
β-Amyloid (25-35)
β-Amyloid (25-35) (Amyloid beta-peptide (25-35)) is the fragment Aβ(25-35) of the Alzheimer's amyloid β-peptide, has shown neurotoxic activities in cultured cells[1]. Uses: Scientific research. Category: Induced disease models products. Alternative Names: Amyloid beta-peptide (25-35); Aβ25-35; β-Amyloid peptide (25-35). CAS No. 131602-53-4. Pack Sizes: 1 mg; 5 mg; 10 mg; 50 mg; 100 mg. Product ID: HY-P0128.
β-Amyloid (25-35), HFIP-treated
β-Amyloid (25-35) (Amyloid beta-peptide (25-35)), HFIP-treated is a β-Amyloid (25-35) (HY-P0128) treated with HFIP. β-Amyloid (25-35) (Amyloid beta-peptide (25-35)) is the fragment Aβ(25-35) of the Alzheimer's amyloid β-peptide, has shown neurotoxic activities in cultured cells[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Amyloid beta-peptide (25-35), HFIP-treated; Aβ25-35, HFIP-treated; β-Amyloid peptide (25-35), HFIP-treated. CAS No. 131602-53-4. Pack Sizes: 1 mg; 1 mg * 5; 1 mg * 10. Product ID: HY-P0128A.
β-Amyloid (42-1), human
β-Amyloid (42-1), human is the inactive form of Amyloid β Peptide (1-42). Its active form, β-Amyloid (1-42), may play a key role in the pathogenesis of Alzheimer's disease[1]. Uses: Scientific research. Category: Induced disease models products. Alternative Names: Amyloid β Peptide (42-1)(human). CAS No. 317366-82-8. Pack Sizes: 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-P1362.
β-Amyloid peptide(16-20)
β-Amyloid peptide(16-20) is a amino acid sequences (KLVFF) of Amyloid-β (Abeta). β-Amyloid peptide(16-20) is an effective inhibitor of Abeta fibril formation, with RG-/-GR-NH2 residues added at N- and C-terminal ends to aid solubility)[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: KLVFF. CAS No. 153247-40-6. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P5124.
β-Amyrin
β-Amyrin shows effectively counteract amyloid β (Aβ)-induced impairment of long-term potentiation (LTP). β-Amyrin is a promising candidate for Alzheimer's disease (AD) research. β-Amyrin exhibits anti-inflammatory effects, protective activity against pulmonary fibrosis, and notable antibacterial capabilities. β-Amyrin is an orally active natural triterpenoid compound[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 559-70-6. Pack Sizes: 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-N2922.
β-Amyrin acetate
β-Amyrin acetate is a triterpenoid with potent anti-inflammatory, antifungal, anti-diabetic, anti-hyperlipidemic activities. β-Amyrin acetate can inhibit HMG-CoA reductase activity by locating in the hydrophobic binding cleft of HMG CoA reductase[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 1616-93-9. Pack Sizes: 5 mg; 10 mg. Product ID: HY-N2923.
β-?Apo-?8'-?carotenal
β-Apo-8'-carotenal (Apocarotenal), an orally active provitamin A carotenoid. β-Apo-8'-carotenal can induce the expression of CYP1A through the Ah receptor-dependent pathway. β-Apo-8'-carotenal can induce cancer cells DNA strand breaks and lipid peroxidation. β-Apo-8'-carotenal can be used for the researches of cancer and metabolic disease[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Apocarotenal. CAS No. 1107-26-2. Pack Sizes: 25 mg; 100 mg. Product ID: HY-N6677.
β-Bisabolene
β-Bisabolene is a sesquiterpene isolated from opoponax (Commiphora guidotti). β-Bisabolene, an anti-cancer agent, can be used for the study of breast cancer[1]. Uses: Scientific research. Category: Natural products. CAS No. 495-61-4. Pack Sizes: 10 mM * 1 mL in DMSO; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-136552.
β-Boswellic acid
β-Boswellic acid is isolated from the gum resin of Boswellia serrata with anticancer, antioxidant activity, anti-inflammatory activity and anti-arthritic pain.β-Boswellic acid is an orally active nonreducing-type inhibitor of the 5-lipoxygenase (5-LO) product formation either interacting directly with the 5-LO or blocking its translocation. β-Boswellic acid inhibits the synthesis of DNA, RNA and protein in human leukemia HL-60 cells with IC50 values ranging from 0.6 to 7.1 μM. β-Boswellic acid is promising for research of diabetes, inflammatory and arthritic diseases[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 631-69-6. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg; 10 mg. Product ID: HY-N2513.
β-Carotene
β-Carotene (Provitamin A), a carotenoid compound, is a naturally-occurring vitamin A precursor. β-Carotene is a modulator of reactive oxygen species (ROS), with antioxidant and antiinflammatory activities. β-Carotene may serve as an antioxidant or as a prooxidant, depending on its intrinsic properties as well as on the redox potential of the biological environment in which it acts. β-Carotene induces breast cancer cells apoptosis, with anticancer activities[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Provitamin A; beta-Carotene. CAS No. 7235-40-7. Pack Sizes: 50 mg; 100 mg; 1 g; 5 g; 10 g; 25 g; 50 g. Product ID: HY-N0411.
β-Carotene-13C10
β-Carotene-13C10 (Provitamin A-13C10) is the 13C-labeled β-Carotene (HY-N0411). β-Carotene (Provitamin A), a carotenoid compound, is a naturally-occurring vitamin A precursor. β-Carotene is a modulator of reactive oxygen species (ROS), with antioxidant and antiinflammatory activities. β-Carotene may serve as an antioxidant or as a prooxidant, depending on its intrinsic properties as well as on the redox potential of the biological environment in which it acts. β-Carotene induces breast cancer cells apoptosis, with anticancer activities[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Provitamin A-13C10; beta-Carotene-13C10. CAS No. 301150-50-5. Pack Sizes: 1 mg. Product ID: HY-N0411S4.
β-Carotene-d8
β-Carotene-d8 is the deuterium labeled β-Carotene (HY-N0411)[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Provitamin A-d8; beta-Carotene-d8. CAS No. 53163-44-3. Pack Sizes: 1 mg; 5 mg. Product ID: HY-N0411S1.
β-Carotene (Standard)
β-Carotene (Standard) is the analytical standard of β-Carotene. This product is intended for research and analytical applications. β-Carotene (Provitamin A), a carotenoid compound, is a naturally-occurring vitamin A precursor. β-Carotene is a modulator of reactive oxygen species (ROS), with antioxidant and antiinflammatory activities. β-Carotene may serve as an antioxidant or as a prooxidant, depending on its intrinsic properties as well as on the redox potential of the biological environment in which it acts. β-Carotene induces breast cancer cells apoptosis, with anticancer activities[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Provitamin A (Standard); beta-Carotene (Standard). CAS No. 7235-40-7. Pack Sizes: 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-N0411R.
β-Caryophyllene
β-Caryophyllene is a CB2 receptor agonist. Uses: Scientific research. Category: Signaling pathways. Alternative Names: (-)-(E)-Caryophyllene; (-)-β-caryophyllene; (-)-trans-Caryophyllene. CAS No. 87-44-5. Pack Sizes: 10 mM * 1 mL in DMSO; 500 mg. Product ID: HY-N1415.
β-Caryophyllene (Standard)
β-Caryophyllene (Standard) is the analytical standard of β-Caryophyllene. This product is intended for research and analytical applications. β-Caryophyllene is a CB2 receptor agonist. Uses: Scientific research. Category: Signaling pathways. Alternative Names: (-)-(E)-Caryophyllene(Standard); (-)-β-caryophyllene(Standard); (-)-trans-Caryophyllene (Standard). CAS No. 87-44-5. Pack Sizes: 100 mg; 500 mg. Product ID: HY-N1415R.
beta-Casein phosphopeptide
beta-Casein phosphopeptide is a biological active peptide. (Bovine -Casein, monophosphopeptide (phospho-Serine) can be used for characterization of affinity purified phosphorylated peptides in liquid chromatography and for the analysis or detection of phosphorylated peptides in mass spectrometry.). Uses: Scientific research. Category: Peptides. CAS No. 183582-09-4. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P5531.