A directory of where to buy chemicals in the USA, including: distributors, industrial manufacturers, bulk supplies and wholesalers of raw ingredients & finished goods.
Search for products or services, then visit the suppliers website for prices or more information.
| Product | Description | |
|---|---|---|
| Sinomenine Hydrochloride | Sinomenine is an optical isomer of Methoxythebainone. Sinomenine was extracted from root of Sinomenium acutum. Sinomenine has anti-inflammatory and analgesic effect. Group: Biochemicals. Alternative Names: (9α, 13α, 14α)-7, 8-Didehydro-4-hydroxy-3, 7-dimethoxy-17-methylmorphinan-6-one Hydrochloride; 7, 8-Didehydro-4-hydroxy-3, 7-dimethoxy-17-methyl-9α, 13α, 14α-morphinan-6-one Hydrochloride; (9α, 13α, 14α)- 7,8-Didehydro-4-hydroxy-3,7-dimethoxy-17-methylmorphinan-6-one Hydrochloride; Cucoline Hydrochloride; NSC 76021; Sinomenin Hydrochloride. Grades: Highly Purified. CAS No. 6080-33-7. Pack Sizes: 1mg. US Biological Life Sciences. |  Worldwide |
| SiNP | SiNP. |  |
| S in-situ doped Ti3AlC2 MAX | This is an in situ sulfur doping strategy that functionalizes MXene nanosheets by introducing heteroatomic sulfur from the MAX precursor into the MXene structure. Three-dimensional folded MXene nanostructures with high specific surface areas were prepared by vacuum freeze-drying. CAS No. 196506-01-1. Purity: 0.99. | |
| S in-situ doped Ti3C2 MXene | Organ-like material, obtained by etching with hydrofluoric acid. CAS No. 12363-89-2. Purity: 0.99. | |
| Sintilimab | Sintilimab (IBI308) is a safe and effectivel humanized IgG4 monoclonal antibody that binds to PD-1 with a KD value of 74 pM. Sintilimab blocks the interaction of PD-1 with its ligands (PD-L1 and PL-L2), consequently helping to restore the endogenous antitumour T-cell response. Sintilimab combined with prebiotics inhibits tumor volume and regulates immune cell subpopulation balance in lung adenocarcinoma mice. Sintilimab can be used for the research of classical Hodgkin's lymphoma, non-small cell lung cancer and oesophageal cancer[1][2][3][4][5]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: IBI308. CAS No. 2072873-06-2. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99048. |  |
| SiO2 Au Core Shell Nanoparticles | SiO2 Au Core Shell Nanoparticles. Purity: 99.9%. | |
| SiO2 coated Upconverting Nanoparticles(green light) | SiO2 coated Upconverting Nanoparticles(green light). | |
| SiO2 coated upconverting nanoparticles(near-infrared light) | SiO2 coated upconverting nanoparticles(near-infrared light). | |
| SiO2 coated Upconverting Nanoparticles(Purple and blue light) | SiO2 coated Upconverting Nanoparticles(Purple and blue light). | |
| SiO2 coated Upconverting Nanoparticles(UV light) | SiO2 coated Upconverting Nanoparticles(UV light). | |
| SiO2 coated Upconverting Nanoparticles(yellow-green light) | SiO2 coated Upconverting Nanoparticles(yellow-green light). | |
| SiO2-COOH modified upconverting nanoparticles (near-infrared light) | SiO2-COOH modified upconverting nanoparticles (near-infrared light). | |
| SiO2-COOH modified upconverting nanoparticles (purple-blue light) | SiO2-COOH modified upconverting nanoparticles (purple-blue light). | |
| SiO2-COOH modified upconverting nanoparticles (Yellow green light) | SiO2-COOH modified upconverting nanoparticles (Yellow green light). | |
| SiO2 NanoFibers | SiO2 NanoFibers. | |
| SiO2 nanopowder | SiO2 nanopowder. Purity: 99%. | |
| SiO2 Nanopowder | SiO2 Nanopowder. CAS No. 7631-86-9. Molecular formula: SiO2. Mole weight: 60.08 g/mol. Purity: 99.9%. | |
| SiO2 Nanospheres | SiO2 Nanospheres. CAS No. 7631-86-9. Molecular formula: SiO2. Mole weight: 60.08 g/mol. Purity: 99.9%. | |
| SiO2-NH2 modified upconverting nanoparticles(Purple-blue light) | SiO2-NH2 modified upconverting nanoparticles(Purple-blue light). | |
| Siomycin | Siomycin is a peptide antibiotic that interacts with the 50S ribosomal subunit and inhibits binding of factor G and aminoacyl-tRNA. It exhibits antitumor activity against certain cancer cell lines. CAS No. 11017-43-9. Molecular formula: C64H88N16O22S4. Mole weight: 1561.73. |  |
| Siomycin A | A macrocyclic antibiotic first isolated from S. sioyaensis with potent and selective antibacterial activity. It is a potent inhibitor of the oncogenic transcription factor, foxm1. It inhibits foxm1-induced cell growth on soft agar and selectively kills transformed but not normal cells in vitro. Alternative Names: Mutabilycin; Sporangiomycin; 6741-21; NSC 285116; Antibiotic 6741-21; (1-L-valine)-[2-(2,3-didehydro-alanine)]-thiostrepton; Thiostrepton, 1-Valine-2-(2,3-didehydroalanine)-. Grades: >95% by HPLC. CAS No. 12656-09-6. Molecular formula: C71H81N19O18S5. Mole weight: 1648.84. | |
| Sipagladenant | Sipagladenant (Compound I) is an orally active adenosine receptor A2A inverse agonist[1]. Sipagladenant can be used in frontal lobe dysfunction research[2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: KW-6356. CAS No. 858979-50-7. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-147400. | |
| Sipatrigine | Sipatrigine. Group: Biochemicals. Grades: Purified. CAS No. 130800-90-7. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| Sipavibart | Sipavibart (AZD3152) is a human IgG1 λ2 monoclonal antibody against SARS-CoV-2. Sipavibart is applicable to research related to COVID-19. The isotype control product for Sipavibart is Human IgG1 lambda2, Isotype Control (HY-P990096)[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: AZD3152. CAS No. 2768288-97-5. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P990766. | |
| Sipeimine | Sipeimine (Imperialine) is an inhibitor targeting the PI3K/AKT/NF-κB pathway and NLRP3 inflammasome, which can competitively bind to PI3K and p65. Sipeimine inhibits PI3K/AKT phosphorylation, blocks NF-κB nuclear translocation and NLRP3 inflammasome activation. Sipeimine exerts anti-inflammatory activities, inhibits pyroptosis and ferroptosis, and protects the extracellular matrix. Sipeimine can reduce cartilage degradation and synovial inflammation in osteoarthritis and improve PM2.5-induced lung injury. Sipeimine is mainly used in the study of anti-inflammatory and degenerative diseases[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Imperialine. CAS No. 61825-98-7. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 250 mg. Product ID: HY-N0696. | |
| Siplizumab | Siplizumab (MEDI-507) is a humanized IgG1 monoclonal antibody against CD2. Siplizumab depletes T cells, decreases T cell activation, inhibites T cell proliferation and enriches naïve and bona fide regulatory T cells[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: MEDI-507; TCD601. CAS No. 288392-69-8. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99904. | |
| Siponimod | Siponimod is a selective S1P1 and S1P5 agonist with EC50 of 0.39 nM and 0.98 nM, respectively. It has been approved by US FDA for the treatment of patients with active secondary progressive multiple sclerosis (SPMS). Alternative Names: BAF-312; BAF 312; BAF312; Siponimod; Mayzent; 1-[[4-[(E)-N-[[4-cyclohexyl-3-(trifluoromethyl)phenyl]methoxy]-C-methylcarbonimidoyl]-2-ethylphenyl]methyl]azetidine-3-carboxylic acid. Grades: >98%. CAS No. 1230487-00-9. Molecular formula: C29H35F3N2O3. Mole weight: 516.6. | |
| Siponimod | Siponimod (BAF-312) is an orally active, blood-brain barrier penetrant dual agonist of S1P1/S1P5, with EC50 values of 0.39 nM and 0.98 nM, respectively. Siponimod induces S1P1 internalization, activates GIRK channels, inhibits lymphocyte egress, reduces peripheral lymphocyte counts, triggers transient bradycardia, prevents synaptic neurodegeneration, promotes remyelination, alleviates demyelination, and prevents the loss of GABAergic interneurons. Siponimod can be used in research related to multiple sclerosis[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: BAF-312. CAS No. 1230487-00-9. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg; 500 mg; 1 g. Product ID: HY-12355. | |
| Siponimod hemifumarate | Siponimod (BAF-312) hemifumarate, a selective and potent modulator of sphingosine-1-phosphate (S1P) receptors, can be used in the study of multiple sclerosis (MS). Category: Active pharmaceutical ingredients. CAS No. 1234627-85-0. Product ID: API1234627850. Molecular formula: C62H74F6N4O10. Mole weight: 1149.282. |  |
| Siponimod Impurity 10 | Siponimod Impurity 10. Uses: For analytical and research use. Molecular formula: C16H19F3O2. Mole weight: 300.32. Catalog: APB10829. |  |
| Siponimod Impurity 11 | Siponimod Impurity 11. Uses: For analytical and research use. CAS No. 1378888-43-7. Molecular formula: C11H14O2. Mole weight: 178.23. Catalog: APB1378888437. | |
| Siponimod Impurity 12 | Siponimod Impurity 12. Uses: For analytical and research use. CAS No. 800379-62-8. Molecular formula: C14H18F3NO. Mole weight: 273.3. Catalog: APB800379628. | |
| Siponimod Impurity 13 | Siponimod Impurity 13. Uses: For analytical and research use. CAS No. 2474774-17-7. Molecular formula: C15H19NO3. Mole weight: 261.32. Catalog: APB2474774177. | |
| Siponimod Impurity 14 | Siponimod Impurity 14. Uses: For analytical and research use. Molecular formula: C29H37F3N2O4. Mole weight: 534.62. Catalog: APB10830. | |
| Siponimod Impurity 15 | Siponimod Impurity 15. Uses: For analytical and research use. Molecular formula: C29H35F3N2O3. Mole weight: 516.61. Catalog: APB10831. | |
| Siponimod Impurity 8 | Siponimod Impurity 8. Uses: For analytical and research use. Molecular formula: C32H40N2O5. Mole weight: 532.68. Catalog: APB10827. | |
| Siponimod Impurity 9 | Siponimod Impurity 9. Uses: For analytical and research use. Molecular formula: C32H40N2O5. Mole weight: 532.68. Catalog: APB10828. | |
| Siramesine | Siramesine (Lu 28-179) is a potent sigma-2 receptor agonist. Siramesine has a subnanomolar affinity for sigma-2 receptors (IC50=0.12?nM) and exhibits a 140-fold selectivity for sigma-2 receptors over sigma-1 receptors (IC50=17?nM). Siramesine triggers cell death through destabilisation of mitochondria, but not lysosomes. Anti-cancer activity[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Lu 28-179. CAS No. 147817-50-3. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-14221. | |
| Siramesine hydrochloride | Siramesine (Lu 28-179) hydrochloride is a potent sigma-2 receptor agonist. Siramesine hydrochloride has a subnanomolar affinity for sigma-2 receptors (IC50=0.12 nM) and exhibits a 140-fold selectivity for sigma-2 receptors over sigma-1 receptors (IC50=17 nM). Siramesine hydrochloride triggers cell death through destabilisation of mitochondria, but not lysosomes. Anti-cancer activity[1][2][3]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: Lu 28-179 hydrochloride. CAS No. 224177-60-0. Pack Sizes: 10 mM * 1 mL in DMSO; 2 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-14221A. | |
| Siramesine hydrochloride | Siramesine hydrochloride is the hydrochloride salt form of Siramesine. Siramesine is a selective sigma-2 receptor agonist with potent anticancer activity in vivo. It was originally devevloped for treating depressant. Alternative Names: Siramesine (hydrochloride); Siramesine HCl; Lu-28-179; Lu 28-179; Lu28-179; Lu-28179; Lu 28179; Lu28179. CAS No. 224177-60-0. Molecular formula: C30H32ClFN2O. Mole weight: 491.04. | |
| Siremadlin | Siremadlin (NVP-HDM201) is a potent, orally bioavailable and highly specific p53-MDM2 interaction inhibitor. Uses: Scientific research. Category: Signaling pathways. Alternative Names: NVP-HDM201; HDM201. CAS No. 1448867-41-1. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-18658. | |
| Sirexatamab | Sirexatamab (DKN-01) is a humanized IgG4 monoclonal antibody that can bind to and neutralize circulating DKK1. Sirexatamab exhibits antitumor activity in tumor models expressing DKK1[1]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: DKN-01; LY-2812176. CAS No. 2414962-49-3. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99906. | |
| Sirius Red Powder C.I. 35780 | 25g Pack Size. Group: Analytical Reagents, Stains & Indicators. Formula: C45H32N10O21S6. CAS No. 2610-10-8. Prepack ID 90028587-25g. Molecular Weight 1373.05. See USA prepack pricing. |  |
| siRNA Electroporation Buffer (30 ml) | Electroporation buffer optimized for high transfection efficacy of siRNA, miRNA, and mRNA into primary cultures and hard-to-transfect cell lines. Uses: Electroporation of DNA, RNA, protein and small molecules. Product ID: 4066. |  Nevada, Texas, USA |
| siRNA Negative Control | siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Alternative Names: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ). | |
| Sirodesmin A | Sirodesmin A is a diketopiperazine antibiotic isolated from the culture broth of Microsphaeropsis sp. FL-16144. TAN-1496 inhibited the relaxation of supercoiled pBR322 DNA by calf thymus topoisomerase I but did not affect the decatenation of kinetoplast DNA by calf thymus topoisomerase II at concentration up to 500 microM. Alternative Names: TAN-1496B; TAN 1496B. CAS No. 52988-50-8. Molecular formula: C20H26N2O8S2. Mole weight: 486.6. | |
| Sirodesmin B | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Alternative Names: Spiro[furan-2(3H),9'(10'H)-[5,11a](iminomethano)[11aH]cyclopenta[4,5]pyrrolo[2,1-e][1,2,3,4,6]tetrathiazocine]-3,6',12'(5'H)-trione, 10'-(acetyloxy)-4,5,7'a,8',10'a,11'-hexahydro-10'ahydroxy-5'-(hydroxymethyl)-4,4,5,13'-tetramethyl-, (2R,5'R,7'aR,10'S,10'aS,11aR)-. CAS No. 52988-51-9. Molecular formula: C20H26N2O8S4. Mole weight: 550.69. | |
| Sirodesmin C | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Alternative Names: Spiro[furan-2(3H),8'(9'H)-[4,10a](iminomethano)[10aH]cyclopenta[4,5]pyrrolo[2,1-d][1,2,3,5]trithiazepine]-3,5',11'(4'H)-trione, 9'-(acetyloxy)hexahydro-9'a-hydroxy-4'-(hydroxymethyl)-4,4,5,12'-tetramethyl-, (2R,4'R,5R,6'aR,9'S,9'aS,10aR)-. CAS No. 52988-52-0. Molecular formula: C20H26N2O8S3. Mole weight: 518.62. | |
| Sirodesmin G | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. CAS No. 64599-26-4. Molecular formula: C20H26N2O8S2. Mole weight: 486.56. | |
| sirohydrochlorin cobaltochelatase | This enzyme is a type II chelatase, being either a monomer (CbiX) or a homodimer (CibK) and being ATP-independent. CbiK from Salmonella enterica uses precorrin-2 as the substrate to yield cobalt-precorrin-2. The enzyme contains two histidines at the active site that are thought to be involved in the deprotonation of the tetrapyrrole substrate as well as in metal binding. CbiX from Bacillus megaterium inserts cobalt at the level of sirohydrochlorin (factor-II) rather than precorrin-2. Group: Enzymes. Synonyms: CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.3. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5360; sirohydrochlorin cobaltochelatase; EC 4.99.1.3; CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Cat No: EXWM-5360. |  |
| sirohydrochlorin ferrochelatase | This enzyme catalyses the third of three steps leading to the formation of siroheme from uroporphyrinogen III. The first step involves the donation of two S-adenosyl-L-methionine-derived methyl groups to carbons 2 and 7 of uroporphyrinogen III to form precorrin-2 (EC 2.1.1.107, uroporphyrin-III C-methyltransferase) and the second step involves an NAD+-dependent dehydrogenation to form sirohydrochlorin from precorrin-2 (EC 1.3.1.76, precorrin-2 dehydrogenase). In Saccharomyces cerevisiae, the last two steps are carried out by a single bifunctional enzyme, Met8p. In some bacteria, steps 1-3 are catalysed by a single multifunctional protein called CysG, whereas in Bacillus megaterium, three separate enzymes carry out each of the steps, with SirB being responsible for the above reaction. Group: Enzymes. Synonyms: CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.4. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5361; sirohydrochlorin ferrochelatase; EC 4.99.1.4; CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Cat No: EXWM-5361. | |
| Sirolimus Liposome | Sirolimus, a metabolite of AYBP44 (streptomyces hygroscopicus), is not only a low-toxicity antibiotic but also a novel immunosuppressant. This product is a pre-formulated liposome with sirolimus. It is only for research purposes. Group: Drug-loaded liposome. |  |
| Sirolimus oxepane isomer | An impurity of Rapamycin. Rapamycin is a macrolide compound. It inhibits activation of T cells and B cells by reducing the production of interleukin-2. Rapamycin can be used to coat coronary stents and prevent organ transplant rejection. Alternative Names: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,28R,34aS)-9,10,12,13,14,21,22,23,24,25,26,28,32,33,34,34a-Hexadecahydro-9,28-dihydroxy-3-[(1R)-2-[(1S,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,28-epoxy-3H-pyrido[2,1-c][1,4]oxaazacyclohentriacontine-1,5,11,27,29(4H,6H,31H)-pentone; Rapamycin, 9,14-deepoxy-15-deoxo-14-deoxy-9,15-epoxy-15-hydroxy-14-oxo-, (15R)-; (15R)-9,14-Deepoxy-15-deoxo-14-deoxy-9,15-epoxy-15-hydroxy-14-oxorapamycin; Rapamycin Impurity 1. Grades: >95%. CAS No. 144293-63-0. Molecular formula: C51H79NO13. Mole weight: 914.19. | |
| Sirolimus triketone isomer | Sirolimus triketone isomer is an impurity of Rapamycin, which is a macrolide compound used to coat coronary stents and prevent organ transplant rejection. Alternative Names: Sirolimus isomer A; Rapamycin isomer A; 10,21-Dimethoxy-6,8,12,14,20,26-hexamethyl-9,10,13,14,21,22,23,24,25,26,32,33,34,34a-tetradecahydro-3H-pyrido[2,1-c][1]oxa[4]azacyclohentriacontine-1,5,11,27,28,29(4H,6H,12H,31H)-hexaone. Grades: 85%. Molecular formula: C51H79NO13. Mole weight: 914.17. | |
| Sirpiglenastat | Sirpiglenastat is a glutaminase inhibitor. Alternative Names: sirpiglenastatum; DRP-104; DRP104. Grades: 95%. CAS No. 2079939-05-0. Molecular formula: C22H27N5O5. Mole weight: 441.5. | |
| Sirpiglenastat | Sirpiglenastat (DRP-104) is a broad acting glutamine antagonist. Sirpiglenastat has anticancer effects by directly targeting tumor metabolism and simultaneously inducing a potent antitumor immune response[1][2]. Uses: Scientific research. Category: Signaling pathways. Alternative Names: DRP-104. CAS No. 2079939-05-0. Pack Sizes: 10 mM * 1 mL in DMSO; 1 mg; 5 mg. Product ID: HY-132832. | |
| SirReal-1 | SirReal-1 is a potent and selective Sirt2 inhibitor (IC50 = 3.7 μM)[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 801227-82-7. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-123653. | |
| SirReal2 | SirReal2 is a potent, isotype-selective Sirt2 inhibitor with an IC50 value of 140?nM and has very little effect on the activities of Sirt3-5. SirReal2 leads to tubulin hyperacetylation in HeLa cells and induces destabilization of the checkpoint protein BubR1. SirReal2 combined with VS-5584 (HY-16585) suppresses tumor growth and extends the survival rate of mice in tumor xenograft model. SirReal2 is is promising for research of cancer, inflammation and neurodegeneration[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 709002-46-0. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-100591. | |
| SirReal 2 | SirReal 2. Group: Biochemicals. Grades: Purified. CAS No. 709002-46-0. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| SIRT1 Antibody [N11B23] | SirT1,Sirt1(Sir2). Group: Antibodies. Alternative Names: SirT1,Sir2. CAS No. Pack Sizes: 20ul. Product ID: F0526. Storage Conditions: -20°C (avoid freeze-thaw cycles), 2 years. |  United States; Europe |
| Sirt2-IN-1 | Sirt2-IN-1 (Compound 9) is a sirtuin 2 (Sirt2) inhibitor with an IC50 of 163 nM[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 1862238-00-3. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 50 mg. Product ID: HY-112427. | |
| Sirt2-IN-2 | Sirt2-IN-2 (Compound 10) is a selective Sirt2 inhibitor with an IC50 of 0.118 μM[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 1862238-01-4. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-112428. | |
| SIRT3 activator 2 | SIRT3 activator 2 (compound 2a) is a SIRT3 activator. SIRT3 activator 2 improved the thermal stability of SIRT3 in SH-SY5Y cells, indicating that it can directly bind to SIRT3, has SIRT3 dependency in SH-SY5Y to clear α-Syn. SIRT3 activator 2 improves motor function in Parkinson mice, preventing Parkinson (DA) neuron loss in the substantia nigra in a dose-dependent manner[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 3061491-60-6. Pack Sizes: 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-163987. | |
| SIRT3-IN-1 | SIRT3-IN-1 (compound 17f) is a SIRT3 inhibitor, with IC50 of 0.043 μM. SIRT3-IN-1 can be used in the research of acute leukemia (AML)[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 3062836-46-5. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-161920. | |
| SIRT4-IN-1 | SIRT4-IN-1 is a selective and potent Sirtuin 4 (Sirt4) inhibitor with an IC50 of 16 μM for hSirt4. SIRT4-IN-1 also inhibits hSirt1, hSirt2, hSirt3, hSirt4 and hSirt6. SIRT4-IN-1 competes with acyl peptide substrate for Sirt4's acyl binding site, and is noncompetitive with NAD+. SIRT4-IN-1 increases glutamate dehydrogenase (GDH) activity and rescues pyruvate dehydrogenase (PDH) activity. SIRT4-IN-1 inhibits adipocyte differentiation and suppresses Sirt4 overexpression-induced increased differentiation. SIRT4-IN-1 can be used for the researches of cancer and metabolic disease[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 3030697-87-8. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-163316. | |
| SIRT5 inhibitor 1 | SIRT5 inhibitor 1 is a potent Human Sirtuin 5 deacylase inhibitor, with an IC50 of 0.11 μM. Uses: Scientific research. Category: Signaling pathways. CAS No. 2166487-21-2. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 50 mg. Product ID: HY-112634. | |
| SIRT6-IN-2 | SIRT6-IN-2 (Compound 5) is a selective and competitive SIRT6 inhibitor (IC50: 34 μM). SIRT6-IN-2 increases acetylation of H3K9 and increases glucose uptake in cultured cells. SIRT6-IN-2 also reduces T cell proliferation. SIRT6-IN-2 has immunosuppressive and chemosensitizing effects[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 891002-11-2. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-103721. | |
| SIRT7 inhibitor 97491 | SIRT7 inhibitor 97491, a potent SIRT7 inhibitor with an IC50 of 325 nM, reduces deacetylase activity of SIRT7 in a dose-dependent manner. SIRT7 inhibitor 97491 prevents tumor progression by increasing p53 stability through acetylation at K373/382. SIRT7 inhibitor 97491 promotes apoptosis through caspase pathway.[1]. Uses: Scientific research. Category: Signaling pathways. CAS No. 1807758-81-1. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-135899. | |
| Sirtinol | Sirtinol is a known inhibitor of the NAD+-Dependent Protein Desuccinylase and Demalonylase Sirt5 and exhibits anticancer properties. Group: Biochemicals. Alternative Names: 2-[[ (2-hydroxy-1-naphthalenyl) methylene]amino]-N- (1-phenylethyl) -benzamide; Sir Two Inhibitor Naphthol. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 10mg, 25mg. US Biological Life Sciences. | Worldwide |
| Sirtinol | Sirtinol is a sirtuin (SIRT) inhibitor, with IC50s of 48 μM, 57.7 μM and 131 μM for ySir2, hSIRT2 and hSIRT2, respectively[1][2][3][4]. Uses: Scientific research. Category: Signaling pathways. CAS No. 410536-97-9. Pack Sizes: 10 mM * 1 mL in DMSO; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-13515. | |
Our database is helping our users find suppliers everyday.
