A directory of where to buy chemicals in the USA, including: distributors, industrial manufacturers, bulk supplies and wholesalers of raw ingredients & finished goods.
Search for products or services, then visit the suppliers website for prices or more information.
| Product | Description | |
|---|---|---|
| Siponimod | Siponimod (BAF-312) is an orally active and selective sphingosine-1-phosphate ( S1P ) receptor modulator. Siponimod is selective for S1P 1 and S1P 5 over S1P 2 , S1P 3 , and S1P 4 , with EC 50 s of 0.4, 0.98, >10000, >1000, and 750 nM, respectively. Siponimod can be used for multiple sclerosis (MS) research [1] - [4]. Uses: Scientific research. Group: Signaling pathways. Alternative Names: BAF-312. CAS No. 1230487-00-9. Pack Sizes: 10 mM * 1 mL; 5 mg; 10 mg; 50 mg; 100 mg; 500 mg; 1 g. Product ID: HY-12355. |  |
| Siponimod | Siponimod. Uses: For analytical and research use. Group: Impurity standards. CAS No. 1230487-00-9. Molecular Formula: C29H35F3N2O3. Mole Weight: 516.61. Catalog: APB1230487009. |  |
| Siponimod | Siponimod is a selective S1P1 and S1P5 agonist with EC50 of 0.39 nM and 0.98 nM, respectively. It has been approved by US FDA for the treatment of patients with active secondary progressive multiple sclerosis (SPMS). Synonyms: BAF-312; BAF 312; BAF312; Siponimod; Mayzent; 1-[[4-[(E)-N-[[4-cyclohexyl-3-(trifluoromethyl)phenyl]methoxy]-C-methylcarbonimidoyl]-2-ethylphenyl]methyl]azetidine-3-carboxylic acid. Grades: >98%. CAS No. 1230487-00-9. Molecular formula: C29H35F3N2O3. Mole weight: 516.6. |  |
| Siponimod Impurity 10 | Siponimod Impurity 10. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C16H19F3O2. Mole Weight: 300.32. Catalog: APB10829. | |
| Siponimod Impurity 11 | Siponimod Impurity 11. Uses: For analytical and research use. Group: Impurity standards. CAS No. 1378888-43-7. Molecular Formula: C11H14O2. Mole Weight: 178.23. Catalog: APB1378888437. | |
| Siponimod Impurity 12 | Siponimod Impurity 12. Uses: For analytical and research use. Group: Impurity standards. CAS No. 800379-62-8. Molecular Formula: C14H18F3NO. Mole Weight: 273.3. Catalog: APB800379628. | |
| Siponimod Impurity 13 | Siponimod Impurity 13. Uses: For analytical and research use. Group: Impurity standards. CAS No. 2474774-17-7. Molecular Formula: C15H19NO3. Mole Weight: 261.32. Catalog: APB2474774177. | |
| Siponimod Impurity 14 | Siponimod Impurity 14. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C29H37F3N2O4. Mole Weight: 534.62. Catalog: APB10830. | |
| Siponimod Impurity 15 | Siponimod Impurity 15. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C29H35F3N2O3. Mole Weight: 516.61. Catalog: APB10831. | |
| Siponimod Impurity 8 | Siponimod Impurity 8. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C32H40N2O5. Mole Weight: 532.68. Catalog: APB10827. | |
| Siponimod Impurity 9 | Siponimod Impurity 9. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C32H40N2O5. Mole Weight: 532.68. Catalog: APB10828. | |
| Siraitia grosvenorii saponin V | Siraitia grosvenorii saponin V. Uses: For analytical and research use. Group: Impurity standards. CAS No. 88901-36-4. Molecular Formula: C60H102O29. Mole Weight: 1287.45. Catalog: APB88901364. | |
| Siramesine | Siramesine is a selective sigma-2 receptor agonist with a potent anticancer activity in vivo. It was originally devevloped for treating depressant and it has pro-apoptotic activity on various transformed cell types. Synonyms: 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] 1-(4-fluorophenyl)-3-(4-(4-(4-fluorophenyl)-1-piperidinyl)-1-butyl)-1H-indole Lu 28-179 Lu-28-179 Siramesine. CAS No. 147817-50-3. Molecular formula: C30H31FN2O. Mole weight: 454.58. | |
| Siramesine fumarate | Siramesine is a sigma receptor agonist with selectivity for σ2 over σ1 (IC50 = 0.19 and 17 nM, respectively). It exhibits anxiolytic and antidepressant effects. Siramesine has been shown to trigger cell death of cancer cells and to exhibit a potent anticancer activity in vivo. Synonyms: Lu 28-179; Siramesine fumarate salt; 1'-[4-[1-(4-fluorophenyl)indol-3-yl]butyl]spiro[1H-2-benzofuran-3,4'-piperidine] fumarate. Grades: ≥98%. CAS No. 163630-79-3. Molecular formula: C30H31FN2O·C4H4O4. Mole weight: 570.7. | |
| Siramesine hydrochloride | Siramesine hydrochloride is the hydrochloride salt form of Siramesine. Siramesine is a selective sigma-2 receptor agonist with potent anticancer activity in vivo. It was originally devevloped for treating depressant. Synonyms: Siramesine (hydrochloride); Siramesine HCl; Lu-28-179; Lu 28-179; Lu28-179; Lu-28179; Lu 28179; Lu28179. CAS No. 224177-60-0. Molecular formula: C30H32ClFN2O. Mole weight: 491.04. | |
| Siremadlin | Siremadlin (NVP-HDM201) is a potent, orally bioavailable and highly specific p53-MDM2 interaction inhibitor. Uses: Scientific research. Group: Signaling pathways. Alternative Names: NVP-HDM201; HDM201. CAS No. 1448867-41-1. Pack Sizes: 10 mM * 1 mL; 1 mg; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-18658. | |
| Sirexatamab | Sirexatamab is an active peptide. Sirexatamab can be used for various biochemical studies. Uses: Scientific research. Group: Inhibitory antibodies. CAS No. 2414962-49-3. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99906. | |
| Sirius Red ≥21% (Dye content) | Sirius Red ≥21% (Dye content). Group: Biochemicals. Grades: Reagent Grade. Pack Sizes: 25g, 100g, 250g. US Biological Life Sciences. |  Worldwide |
| Sirius Red Powder C.I. 35780 | 25g Pack Size. Group: Analytical Reagents, Stains & Indicators. Formula: C45H32N10O21S6. CAS No. 2610-10-8. Prepack ID 90028587-25g. Molecular Weight 1373.05. See USA prepack pricing. |  |
| siRNA Electroporation Buffer (30 ml) | Electroporation buffer optimized for high transfection efficacy of siRNA, miRNA, and mRNA into primary cultures and hard-to-transfect cell lines. Uses: Electroporation of DNA, RNA, protein and small molecules. Product ID: 4066. |  Nevada, Texas, USA |
| SiRNA Negative Control | siRNA Negative Control is a siRNA of 21 nucleotides, and can be used as a negative control. It is recommended as a negative control for evaluating RNAi off-target effects, and in order to verify the accuracy of gene specific siRNA dependent RNAi. Synonyms: RNA, (UUCUCCGAACGUGUCACGUUU), complex with RNA (UUAAGAGGCUUGCACAGUGCA). Mole weight: 13323 ( AS: 6586.9; SS: 6736.1 ). | |
| Sirodesmin A | Sirodesmin A is a diketopiperazine antibiotic isolated from the culture broth of Microsphaeropsis sp. FL-16144. TAN-1496 inhibited the relaxation of supercoiled pBR322 DNA by calf thymus topoisomerase I but did not affect the decatenation of kinetoplast DNA by calf thymus topoisomerase II at concentration up to 500 microM. Synonyms: TAN-1496B; TAN 1496B. CAS No. 52988-50-8. Molecular formula: C20H26N2O8S2. Mole weight: 486.6. | |
| Sirodesmin B | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 9' (10'H)-[5, 11a] (iminomethano)[11aH]cyclopenta[4, 5]pyrrolo[2, 1-e][1, 2, 3, 4, 6]tetrathiazocine]-3, 6', 12' (5'H)-trione, 10'-(acetyloxy)-4,5,7'a,8',10'a,11'-hexahydro-10'ahydroxy-5'-(hydroxymethyl)-4,4,5,13'-tetramethyl-, (2R,5'R,7'aR,10'S,10'aS,11aR)-. CAS No. 52988-51-9. Molecular formula: C20H26N2O8S4. Mole weight: 550.69. | |
| Sirodesmin C | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. Synonyms: Spiro[furan-2 (3H), 8' (9'H)-[4, 10a] (iminomethano)[10aH]cyclopenta[4, 5]pyrrolo[2, 1-d][1, 2, 3, 5]trithiazepine]-3, 5', 11' (4'H)-trione, 9'-(acetyloxy)hexahydro-9'a-hydroxy-4'-(hydroxymethyl)-4,4,5,12'-tetramethyl-, (2R,4'R,5R,6'aR,9'S,9'aS,10aR)-. CAS No. 52988-52-0. Molecular formula: C20H26N2O8S3. Mole weight: 518.62. | |
| Sirodesmin G | It is produced by the strain of Sirodesmum diversum. It has antiviral effect. CAS No. 64599-26-4. Molecular formula: C20H26N2O8S2. Mole weight: 486.56. | |
| sirohydrochlorin cobaltochelatase | This enzyme is a type II chelatase, being either a monomer (CbiX) or a homodimer (CibK) and being ATP-independent. CbiK from Salmonella enterica uses precorrin-2 as the substrate to yield cobalt-precorrin-2. The enzyme contains two histidines at the active site that are thought to be involved in the deprotonation of the tetrapyrrole substrate as well as in metal binding. CbiX from Bacillus megaterium inserts cobalt at the level of sirohydrochlorin (factor-II) rather than precorrin-2. Group: Enzymes. Synonyms: CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.3. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5360; sirohydrochlorin cobaltochelatase; EC 4.99.1.3; CbiK; CbiX; CbiXS; anaerobic cobalt chelatase; cobaltochelatase [ambiguous]; sirohydrochlorin cobalt-lyase (incorrect). Cat No: EXWM-5360. |  |
| sirohydrochlorin ferrochelatase | This enzyme catalyses the third of three steps leading to the formation of siroheme from uroporphyrinogen III. The first step involves the donation of two S-adenosyl-L-methionine-derived methyl groups to carbons 2 and 7 of uroporphyrinogen III to form precorrin-2 (EC 2.1.1.107, uroporphyrin-III C-methyltransferase) and the second step involves an NAD+-dependent dehydrogenation to form sirohydrochlorin from precorrin-2 (EC 1.3.1.76, precorrin-2 dehydrogenase). In Saccharomyces cerevisiae, the last two steps are carried out by a single bifunctional enzyme, Met8p. In some bacteria, steps 1-3 are catalysed by a single multifunctional protein called CysG, whereas in Bacillus megaterium, three separate enzymes carry out each of the steps, with SirB being responsible for the above reaction. Group: Enzymes. Synonyms: CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Enzyme Commission Number: EC 4.99.1.4. Storage: Store it at +4 ?C for short term. For long term storage, store it at -20 ?C?-80 ?C. Form: Liquid or lyophilized powder. EXWM-5361; sirohydrochlorin ferrochelatase; EC 4.99.1.4; CysG; Met8P; SirB; sirohydrochlorin ferro-lyase (incorrect). Cat No: EXWM-5361. | |
| Sirolimus isoform 2 | Sirolimus isoform 2. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C38H57NO11. Mole Weight: 703.87. Catalog: APB09601. | |
| Sirolimus isoform 3 | Sirolimus isoform 3. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C52H81NO13. Mole Weight: 928.21. Catalog: APB09600. | |
| Sirolimus Liposome | Sirolimus, a metabolite of AYBP44 (streptomyces hygroscopicus), is not only a low-toxicity antibiotic but also a novel immunosuppressant. This product is a pre-formulated liposome with sirolimus. It is only for research purposes. Group: Drug-loaded liposome. Categories: liposomes, niosomes, ethosomes, and transfersomes. |  |
| Sirolimus trione isomer | Sirolimus trione isomer. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C51H79NO13. Mole Weight: 914.19. Catalog: APB09602. | |
| Sirpiglenastat | Sirpiglenastat is a glutaminase inhibitor. Synonyms: sirpiglenastatum; DRP-104; DRP104. Grades: >98%. CAS No. 2079939-05-0. Molecular formula: C22H27N5O5. Mole weight: 441.5. | |
| SirReal2 | SirReal2 selectively targets SIRT2 and decreases migration as well as invasion in human GC cells. Synonyms: SirReal 2. Grades: 98%. CAS No. 709002-46-0. Molecular formula: C22H20N4OS2. Mole weight: 420.55. | |
| SirReal 2 | SirReal 2. Group: Biochemicals. Grades: Purified. CAS No. 709002-46-0. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| SIRT1/2/3 pan Inhibitor (pan SIRT1/2/3 Inhibitor, 4- (4- (2-Pivalamidoethyl) piperidin-1-yl) thieno[3, 2-d]pyrimidine-6-carboxamide) | A thienopyrimidinyl carboxamide that acts as a highly potent, reversible pan sirtuin (SIRT) inhibitor (IC50 = 15, 10, and 33nM for SIRT1, 2, and 3, respectively). Shown to bind to the SIRT catalytic site and occupy both the nicotinamide C-pocket and acetyl lysine substrate channel. Exhibits high selectivity over a panel of protein kinases, nuclelar receptors, GPCRs, and ion-channels (IC50 > 10uM). Poorly affects hERG and cytochrome P450s (> 50uM). Exhibits desirable stability in microsomal preparations (human CLint = 15.8 uL/min/mg, mouse CLint = 12.7uL/min/mg) and high solubility (297uM), and low LogD (2.73). Group: Biochemicals. Grades: Highly Purified. Pack Sizes: 10mg. Molecular Formula: C??H??N?O?S. US Biological Life Sciences. | Worldwide |
| SIRT1 Activator II (3- (Benzenesulfonyl) -1- (4-fluorophenyl) pyrrolo[4, 5-b]quinoxalin-2-amine) | A cell-permeable pyrroloquinoxaline compound that acts as a reversible SIRT1 activator (10uM causes ~2.3-fold fluorescent enhancement in a fluorescent assay using hrSIRT1) and enhances fat mobilization in fully differentiated 3T3L1 fibroblasts. Shown to inhibit LPS-induced TNF-a release in THP-1 cells by ~10-fold more potent than resveratrol. Group: Biochemicals. Grades: Highly Purified. CAS No. 374922-43-7. Pack Sizes: 10mg. Molecular Formula: C??H??FN?O?S, Molecular Weight: 418.4. US Biological Life Sciences. | Worldwide |
| SIRT1-IN-2 | SIRT1-IN-2 (compound 3h) is a potent and selective SIRT1 (silent information regulator 1) inhibitor, with an IC 50 of 1.6 μM [1]. Uses: Scientific research. Group: Signaling pathways. CAS No. 2470969-89-0. Pack Sizes: 10 mM * 1 mL; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-146689. | |
| SIRT1-IN-3 | SIRT1-IN-3 (compound 3j) is a potent and selective SIRT1 inhibitor, with an IC 50 of 4.2 μM [1]. Uses: Scientific research. Group: Signaling pathways. CAS No. 2470969-91-4. Pack Sizes: 10 mM * 1 mL; 5 mg; 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-146690. | |
| SIRT1-IN-4 | SIRT1-IN-4 (Compound 8c) is a SIRT1 inhibitor, with an IC 50 of 10.04 μM. SIRT1-IN-4 can be used for the research of cancer [1]. Uses: Scientific research. Group: Signaling pathways. CAS No. 445405-18-5. Pack Sizes: 5 mg; 10 mg. Product ID: HY-169934. | |
| SIRT2 Inhibitor (3-(1-azepanylsulfonyl)-N-(3-bromphenyl)benzamide) | Brain-permeable. A potent and selective sirtuin 2 deacetylase (SIRT2) inhibitor. Reduces neuronal cholesterol by inhibiting SIRT2 activity. Group: Biochemicals. Grades: Highly Purified. CAS No. 420831-40-9. Pack Sizes: 5mg, 25mg. US Biological Life Sciences. | Worldwide |
| Sirtinol | Sirtinol is a sirtuin (SIRT) inhibitor, with IC 50 s of 48 μM, 57.7 μM and 131 μM for ySir2, hSIRT2 and hSIRT2, respectively [1] [2] [3] [4]. Uses: Scientific research. Group: Signaling pathways. CAS No. 410536-97-9. Pack Sizes: 10 mM * 1 mL; 5 mg; 10 mg; 50 mg; 100 mg. Product ID: HY-13515. | |
| Sirtinol | Sirtinol is a known inhibitor of the NAD+-Dependent Protein Desuccinylase and Demalonylase Sirt5 and exhibits anticancer properties. Group: Biochemicals. Alternative Names: 2-[[ (2-hydroxy-1-naphthalenyl) methylene]amino]-N- (1-phenylethyl) -benzamide; Sir Two Inhibitor Naphthol. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 10mg, 25mg. US Biological Life Sciences. | Worldwide |
| Sirtinol | Sirtinol is a SIRT inhibitor. Sirtinol significantly increased the acetylation of p53, which has been reported to be a target of SIRT1/2. Sirtinol significantly increased the G1 phase of the cell cycle. Synonyms: 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide; 2-{[(2-hydroxy-1-naphthyl)methylene]amino}-N-(1-phenylethyl)benzamide; 2-[(2-hydroxynaphthalen-1-yl)methylideneamino]-N-(1-phenylethyl)benzamide; Sir Two Inhibitor Naphthol; (E)-2-((2-hydroxynaphthalen-1-yl)methyleneamino)-N-(1-phenylethyl)benzamide; 2-(((2-Hydroxynaphthalen-1-yl)methylene)amino)-N-(1-phenylethyl)benzamide; 2-[[(2-Hydroxy-1-naphthalenyl)methylene]amino]- N -(1-phenylethyl)benzamide; (E)-2-(((2-HYDROXYNAPHTHALEN-1-YL)METHYLENE)AMINO)-N-(1-PHENYLETHYL)BENZAMIDE; {2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]}-N-(1-phenethyl)benzamide (Sirtinol. Grades: 0.98. CAS No. 410536-97-9. Molecular formula: C26H22N2O2. Mole weight: 394.474. | |
| Sirtinol (SIRT2 Inhibitor Naphthol) | Cell-permeable. A selective sirtuin deacetylase inhibitor with IC50 values of 38, 68 and 131uM for SIRT2, Sir2p and SIRT1 respectively. Sirtinol has no effect on HDAC1 activity. Sirtinol inhibits the growth of cancer cells and suppresses inflammatory signaling in human dermal microvascular endothelial cells. Group: Biochemicals. Alternative Names: 2-[(2-Hydroxynaphthalen-1-ylmethylene)amino]-N-(1-phenethyl)benzamide. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 5mg. US Biological Life Sciences. | Worldwide |
| Sirtinol (Sir Two Inhibitor Naphthol, 2-N-(1-phenethyl)benzamide) | Specific cell permeable SIRT1 (sirtuin-1) inhibitor. Senescence-like growth arrest inducer. Platelet aggregation inhibitor. Apoptosis inducer. Group: Biochemicals. Alternative Names: Sir Two Inhibitor Naphthol, 2--N-(1-phenethyl)benzamide. Grades: Highly Purified. CAS No. 410536-97-9. Pack Sizes: 1mg, 5mg, 25mg. Molecular Formula: C??H??N?O?. US Biological Life Sciences. | Worldwide |
| Sirtuin-1 inhibitor 1 | Sirtuin-1 inhibitor 1 (Compound 8) is an inhibitor of Sirtuin -1 that plays important roles in obesity-induced diabetes and aging-related diseases [1]. Uses: Scientific research. Group: Signaling pathways. CAS No. 945114-10-3. Pack Sizes: 5 mg; 10 mg; 25 mg; 50 mg. Product ID: HY-156781. | |
| Sirtuin-3 Inhibitor, SRT1720 (SIRT3 Inhibitor II, N- (2- (3- (1-Piperazinylmethyl) imidazo[2, 1-b]thiazol-6-yl) phenyl) -2-quinolinecarboxamide) | A cell-permeable quinolinecarboxamide compound that is shown to inhibit the mitochondrial SIRT3 in a substrate AceCS2-competitive (Ki = 0.56uM; Km = 2.44uM), but NAD+-uncompetitive (Ki = 0.34uM; Km = 280uM), manner. Also reported to decrease cellular p53 Lys382 acetylation (Effective conc. = 10uM in U2OS and MEF cultures) and inhibit p300 HAT activity (IC50 = 9uM) in vitro, as well as offer therapeutic benefits in several murine and rodent type 2 diabetes models (100mg/kg/dayl p.o.) in vivo. Whether and how SRT1720 activates SIRT1 activity remains uncertain. Group: Biochemicals. Grades: Highly Purified. CAS No. 925434-55-5. Pack Sizes: 10mg. US Biological Life Sciences. | Worldwide |
| Sirukumab | Sirukumab (CNTO-136) is a humanized monoclonal anti- IL6 (Interleukin Related) IgG1κ antibody. Sirukumab binds to IL6 , preventing IL6-mediated signal transduction and activation of transcriptional activators, thereby blocking the downstream biological effects of IL6. Sirukumab can be used in the study of active lupus nephritis and rheumatoid arthritis [1] [2]. Uses: Scientific research. Group: Inhibitory antibodies. Alternative Names: CNTO-136. CAS No. 1194585-53-9. Pack Sizes: 1 mg; 5 mg; 10 mg. Product ID: HY-P99316. | |
| SIS3 | SIS3. Group: Biochemicals. Grades: Purified. CAS No. 521984-48-5. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| SIS3 HCl | SIS3 is a potent and specific inhibitor of Smad3 via inhibiting the effects of TGF-β1. SIS3 inhibits TGF-β and activin signaling by suppressing Smad3 phosphorylation with no effect on Smad2, p38 MAPK, ERK or PI 3-kinase signaling. It inhibits TGF-β1-induced myofibroblast differentiation of dermal fibroblasts. Synonyms: (2E)-1-(6,7-Dimethoxy-3,4-dihydro-1H-isoquinolin-2-yl)-3-(1-methyl-2-phenyl-1H-pyrrolo[2,3-b]pyridin-3-yl)-propenone hydrochloride. Grades: >98%. CAS No. 521984-48-5. Molecular formula: C28H27N3O3.HCl. Mole weight: 489.99. | |
| Sisomicin | Sisomicin is a broad-spectrum aminoglycoside antibiotic produced by Micromonospora inyoensis. Sisomicin is highly active against Gram-positive bacteria [1] [2]. Uses: Scientific research. Group: Natural products. Alternative Names: Antibiotic 6640; Rickamicin. CAS No. 32385-11-8. Pack Sizes: 5 mg; 10 mg. Product ID: HY-B1222A. | |
| Sisomicin | Antibacterial. Gentamicin-like aminoglycoside antibiotic; has broad spectrum antibiotic activity. Group: Biochemicals. Alternative Names: O-3-Deoxy-4-C-methyl-3-(methylamino)- β-L-arabinopyranosyl-(1-6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1-4)]-2-deoxy- D-Streptamine; Antibiotic 66-40; Antibiotic 6640; Rickamicin; Sch 13475; Siseptin. Grades: Highly Purified. CAS No. 32385-11-8. Pack Sizes: 1g. US Biological Life Sciences. | Worldwide |
| Sisomicin | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis NRRL 3292. It has a broad-spectrum antibacterial effects against Gram-positive and Gram-negative bacteria including B. subtilis, S. aureus, E. coli, and P. aeruginosa. It has no cross-resistance to kanamycin, but has cross-resistance to gentamycin. 50 mg/kg of Sisomicin has protective effect on mice infected with Rickettsia spinosa. Uses: Protein synthesis inhibitors. Synonyms: D-Streptamine, O-3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-; Antibiotic 6640; SCH 13475; Rickamicin; Sisomycin; Sissomicin; O-3-Deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl-(1?6)-O-[2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hex-4-enopyranosyl-(1?4)]-2-deoxy-D-streptamine; Antibiotic 66-40; BactoCeaze; Ensamycin; Sch 13475; Siseptin. Grades: ≥98%. CAS No. 32385-11-8. Molecular formula: C19H37N5O7. Mole weight: 447.53. | |
| Sisomicin B | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis. It has broad-spectrum antimicrobial activity. Synonyms: Sisomicin B; 6-O-[3-Deoxy-3-(methylamino)-α-D-xylopyranosyl]-4-O-(2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hexa-4-enopyranosyl)-2-deoxy-D-streptamine; Antibiotic 66-40B; 6640B; D-Streptamine, O-3-deoxy-3-(methylamino)-alpha-D-xylopyranosyl-(1-6)-o-(2,6-diamino-2,3,4,6-tetradeoxy-alpha-D-glycero-hex-4-enopyranosyl-(1-4))-2-deoxy-. CAS No. 53797-16-3. Molecular formula: C18H35N5O7. Mole weight: 433.50. | |
| Sisomicin D | It is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis. It has broad-spectrum antimicrobial activity. Synonyms: 6-O-[3-Deoxy-3-(methylamino)-β-L-arabinopyranosyl]-4-O-(2,6-diamino-2,3,4,6-tetradeoxy-α-D-glycero-hexa-4-enopyranosyl)-2-deoxy-D-streptamine; Antibiotic 66-40D; 66-40D. CAS No. 53759-50-5. Molecular formula: C18H35N5O7. Mole weight: 433.50. | |
| Sisomicin impurity 1 | Sisomicin impurity 1. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C12H24N4O4. Mole Weight: 288.35. Catalog: APB11397. | |
| Sisomicin impurity 2 | Sisomicin impurity 2. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C18H35N5O7. Mole Weight: 433.51. Catalog: APB11396. | |
| Sisomicin impurity 3 | Sisomicin impurity 3. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C18H35N5O7. Mole Weight: 433.51. Catalog: APB11399. | |
| Sisomicin impurity 4 | Sisomicin impurity 4. Uses: For analytical and research use. Group: Impurity standards. CAS No. 53759-50-5. Molecular Formula: C18H35N5O7. Mole Weight: 433.51. Catalog: APB53759505. | |
| Sisomicin impurity 5 | Sisomicin impurity 5. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C19H35N5O8. Mole Weight: 461.52. Catalog: APB11401. | |
| Sisomicin impurity 6 | Sisomicin impurity 6. Uses: For analytical and research use. Group: Impurity standards. CAS No. 53797-16-3. Molecular Formula: C18H35N5O7. Mole Weight: 433.51. Catalog: APB53797163. | |
| Sisomicin impurity 7 | Sisomicin impurity 7. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C12H24N4O4. Mole Weight: 288.35. Catalog: APB11400. | |
| Sisomicin impurity 8 | Sisomicin impurity 8. Uses: For analytical and research use. Group: Impurity standards. Molecular Formula: C18H35N5O7. Mole Weight: 433.51. Catalog: APB11402. | |
| Sisomicin sulfate | Sisomicin sulfate is a broad-spectrum aminoglycoside antibiotic produced by Micromonospora inyoensis. Sisomicin sulfate is highly active against Gram-positive bacteria [1] [2] [3] [4]. Uses: Scientific research. Group: Natural products. CAS No. 53179-09-2. Pack Sizes: 10 mM * 1 mL; 100 mg; 250 mg; 500 mg. Product ID: HY-B1222. | |
| Sisomicin sulfate | Sisomicin sulfate. Group: Biochemicals. Grades: Highly Purified. CAS No. 53179-09-2. Pack Sizes: 250mg, 500mg, 1g, 2g, 5g. Molecular Formula: 2C19H37N5O7·5H2SO4. US Biological Life Sciences. | Worldwide |
| Sisomicin Sulfate | Sisomicin Sulfate is an aminoglycoside antibiotic produced by the strain of Micromonospora inyoensis NRRL 3292. It has a broad-spectrum antibacterial effects against Gram-positive and Gram-negative bacteria. Uses: Protein synthesis inhibitors. Synonyms: D-Streptamine, 4-O-[(2S,3R)-3-amino-6-(aminomethyl-3,4-dihydro-2H-pyran-2-y1]-2-deoxy-6-O-[3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl]-, sulfate (salt); D-Streptamine, 4-O-[3-amino-6-(aminomethyl-3,4-dihydro-2H-pyran-2-y1]-2-deoxy-6-O-[3-deoxy-4-C-methyl-3-(methylamino)-β-L-arabinopyranosyl]-, (2S-cis)-, sulfate (salt). Grades: ≥95%. CAS No. 53776-71-9. Molecular formula: C19H37N5O7.xH2O4S. Mole weight: 447.52 (free base). | |
| Sisomicin (sulfate) (Standard) | Sisomicin (sulfate) (Standard) is the analytical standard of Sisomicin (sulfate). This product is intended for research and analytical applications. Sisomicin sulfate is a broad-spectrum aminoglycoside antibiotic produced by Micromonospora inyoensis. Sisomicin sulfate is highly active against Gram-positive bacteria [1] [2] [3] [4]. Uses: Scientific research. Group: Natural products. CAS No. 53179-09-2. Pack Sizes: 10 mg; 25 mg; 50 mg; 100 mg. Product ID: HY-B1222R. | |
| S-Isopropylisothiourea hydrobromide | S-Isopropylisothiourea hydrobromide is the hydrobromide form of S-Isopropylisothiourea, which is a potent non-selective nitric oxide synthase (NOS) inhibitor. It has selectivity for the inducible form and is selective in vitro but may lack good in vivo efficacy due to poor cellular penetration. Its Ki values are 9.8, 22, and 37 nM using purified human iNOS, eNOS, and nNOS, respectively. It may be useful as a target for various disease models. Synonyms: Carbamimidothioic acid, 1-methylethyl ester, monohydrobromide; 2-Isopropyl-2-thiopsuedourea Hydrobromide; IPITU hydrobromide; S-Isopropylthiuronium bromide; Pseudourea, 2-isopropyl-2-thio-, hydrobromide; Isopropyl carbamimidothioate hydrobromide; S-Isopropyl-ITU hydrobromide; S-Isopropylisothiourea monohydrobromide. Grades: ≥95%. CAS No. 4269-97-0. Molecular formula: C4H11N2SBr. Mole weight: 199.11. | |
| S-Isopropylisothiourea hydrobromide | S-Isopropylisothiourea hydrobromide. Group: Biochemicals. Grades: Purified. CAS No. 4269-97-0. Pack Sizes: 10mg, 50mg. US Biological Life Sciences. | Worldwide |
| S-Isopropylisothiourea hydrobromide | S-Isopropylisothiourea (IPTU) hydrobromide is a potent and selective inhibitor of Nitric Oxide Synthase (NOS). S-Isopropylisothiourea (IPTU) hydrobromide is used in the research for hemorrhagic shock [1] [2]. Uses: Scientific research. Group: Signaling pathways. Alternative Names: S-isopropyl ITU; IPTU. CAS No. 4269-97-0. Pack Sizes: 25 mg; 50 mg; 100 mg. Product ID: HY-101304. | |
Our database is helping our users find suppliers everyday.
